We narrowed to 5 results for: gfp p53
-
TypeBlog Post...Chang-Deng Hu Green sfGFP Split super-folder GFP, our most-requested GFP(1-10) and GFP(11) Versatile protein...Commun. 2016 Bo Huang spGFP Split superpositive GFP Split-superpositive GFP reassembly is a fast, efficient...fragment Constant rate of p53 tetramerization in response to DNA damage controls the p53 response. Gaglia G,...base FP (for example, EBFP2(1-10) can be used with GFP(11)). Some of the articles linked below only provide...Blue EBFP2 EBFP2(1-10) and Capri(1-10) for use with GFP(11) Multiplexed labeling of cellular proteins with... Kamiyama Cerulean Cerulean(1-10) for use with GFP(11) Multiplexed labeling of cellular proteins with...background signal (especially for some older split-GFP constructs or certain cell environments). Also consider...
-
Zhang Lab CRISPR Page
TypeCollection...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ...PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: ... cancer modeling 60224 : sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, ... . simultaneously modeled the dynamics of KRAS , p53 and LKB1 , the top three significantly mutated genes...the lung generated loss-of-function mutations in p53 and Lkb1 , as well as homology directed repair-mediated...described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR... -
Luciferase Plasmid Collection
TypeCollection...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...phGluc Gaussia EF1α Expression of Gaussia luciferase; GFP is expressed if cells are infected with virus Christopher...Firefly TGB AAV expression of firefly luciferase and GFP James Wilson 106457 pCR3.1-Luc Firefly CMV Mammalian...transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen Venken... -
Validated gRNA Sequences
TypeCollection...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article 60224...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria... -
Trimmer Lab NeuroMab Collection
TypeCollection...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-.../22R] Prrt2 Mouse Mouse IgG2a 188166 Anti-GFP [N86/20R] GFP Aequorea victoria Mouse IgG2a 188167 Anti-...