Skip to main content
Addgene
Showing: 1 - 20 of 429 results

  1. Synthetic Biology - Overview

    Type
    Collection
    ...SynBio Blog Genome Engineering SynBio Depositing Labs Hal Alper J. Chris Anderson Adam Arkin Gabor Balazsi ...

  3. Countdown to Halloween @Addgene

    Type
    Blog Post
    ...Halloween is only 2 days away and here at Addgene we couldn’t be more excited! As a small, tight-knit...things: fun, teamwork, and competition. And our Halloween celebration this Friday will combine all of these...these. Addgenies have been organizing Halloween festivities for years – searching our photo archives I...destroyed to protect the innocent revelers. Our Halloween costume contests have become an annual tradition...colleagues. Success is sweet – as sweet as all that Halloween candy you’ll gorge yourself on in the coming days...Hopefully, I’ve made clear how excited we get for Halloween and how seriously we take costume design. In case...continue to have an amazing turnout for the annual Halloween costume, so I expect some great costumes this ...

  4. Overcoming the Challenges of Lentiviral Production

    Type
    Blog Post
    ...tools, producing lentivirus, can pose certain challenges. Whether choosing a system that is the best fit...will provide an overview of some of the common challenges associated with producing and using lentivirus...make these optimization experiments a bit more challenging. With these considerations in mind, when planning...

  5. 3 Challenges in Plant Synthetic Biology

    Type
    Blog Post
    ...ve had to navigate the challenges involved in plant synthetic biology. Challenge #1: Public perception ...facilitates plant science. Challenge #3: Intellectual property There is another challenge associated with molecular... of well-characterized genetic tools make it challenging to engineer a specific function in these multicellular...fibers. And because working with plants can be challenging, there are a lot of unexplored areas in plant...manner. At Revolution Bio, we are addressing this challenge directly by developing a plant biotechnology product...inspire and open a new conversation about GMOs.  Challenge #2: Technical obstacles to plant synthetic biology... a product without the use of these parts is challenging, and it’s made even more difficult by the fact...

  6. Streaking for Single Colonies: The Streak Plate Challenge

    Type
    Blog Post
    ...plate technique. Time for the #BioSci3319 #StreakPlateChallenge part 1. Lab B needs a redo :-( @SandTBioSci... the lab used three different species for the challenge, but one species always outcompeted the other ...it would be a perfect fit for the streak plate challenge. Chromoproteins are a subset of the fluorescent... distinguish colonies from one another in the challenge. To create a successful streak plate, first the...colonies in the last quadrant after incubation. The challenge is usually successful for the students. “They ...colonies. I should probably make it a bit more challenging, potentially by using a thicker bacterial suspension...transformation efficiency.  Aside from the Streak Plate Challenge, Westenberg’s course includes Winogradsky columns...

  7. CRISPR Challenges: Standardization and Homology Directed Repair

    Type
    Blog Post
    ...that this basic concept of gRNA design is still challenging for researchers using CRISPR, and that standardizing...paraphrased in the tweet below. The complexity and challenges of homology directed repair (HDR) are echoed ...s a list of blog posts to help you tackle the challenges of DNA repair (with bonus gRNA design resources...Creating knock-in mouse models with CRISPR has been challenging, with protocols using dsDNA templates achieving...

  9. Six Spooky Science Stories and Halloween at Addgene

    Type
    Blog Post
    ...another snail, completing its lifecycle. Halloween genes The Halloween genes are a set of cytochrome P450 genes...incorporate science themes into our fun activities and Halloween is no exception. For the past 10+ years, Addgenies...ping pong table. This year, in addition to the Halloween contest, we’ve also carved pumpkins (yes, Blugene...melanogaster (Gilbert, 2004). Mutations in these genes are lethal, associated with defective exoskeleton formations...1983.3 (1983): 813-816. Gilbert, Lawrence I. "Halloween genes encode P450 enzymes that mediate steroid...company culture at Addgene See some of our previous Halloween costume contests ...

  10. Designing Your Chalk Talk for the Academic Job Interview

    Type
    Blog Post
    ...I include in my chalk talk?" So what exactly is a chalk talk? On the surface, a chalk talk is quite simple...present a "chalk talk." However, few, if any, faculty job candidates have seen an actual chalk talk. Their...first exposure to a chalk talk is usually their own. This is a problem. The chalk talk is effectively ... hone a chalk talk. Yet, I often hear, "I have an interview next week and it includes a chalk talk. What...steps to chalk talk preparation: Define your research vision. Organize your vision into a chalk talk format...simple. It's you, a dry erase board, some markers (chalk is rare these days), and a room of 5-30 faculty ...format. Practice. Define your research vision A chalk talk could be your plans for your first NIH R01 ...

  11. Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers

    Type
    Blog Post
    ...portion of the genome. Mendenhall and Richard Myers of HudsonAlpha (where Mendenhall is also an adjunct faculty...As Eric Mendenhall of the University of Alabama in Huntsville explains it, a major goal in his laboratory...Cas9 system for protein tagging. We spoke with Mendenhall and Myers about their new CRISPR tagging system...transcription factors. Addgene: How does the system work? Mendenhall: The system is really quite simple but it offers...advantages does your system have in this context? Mendenhall: The benefits are two-fold: CRISPR/Cas9 offers... Besides being fast and efficient, what other challenges does this system help to solve? Myers: Only a...works on a large scale. The world is too big now. Mendenhall: So many groups have been struggling with this...

  12. Gibson Assembly Protocol

    Type
    Protocol
    ...part, one part has half of the antibiotic gene and the adjacent part has the other half. Any colonies should...

  13. Isolating a Monoclonal Cell Population by Limiting Dilution

    Type
    Protocol
    ...medium at a reduced antibiotic concentration (e.g., half the concentration that was used for the initial ...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nature Methods. 2014 Aug;11(8):783-...

  14. Weighing Reagents Protocol

    Type
    Protocol
    ...Pro-Tip If you’re using weighing paper, fold it in half first to create a crease and then place it unfolded...

  15. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 161767 FUS_Halo_N_allele_400 FUS Halo ALS Michael Ward 161768 FUS_Halo_C_allele_400 FUS Halo ALS Michael...Melcher 178115 ANG_Halo_C_allele ANG Halo ALS Michael Ward 178116 PRNP_Halo_C_allele PRNP Halo Dementia Michael...178117 PFN1_Halo_C_allele PFN1 Halo ALS Michael Ward 178118 CHCHD10_Halo_N_allele CHCHD10 Halo ALS Michael...178119 UBQLN2_Halo_C_allele UBQLN2 Halo ALS Michael Ward 178120 SIGMAR1_Halo_C_allele SIGMAR1 Halo ALS Michael...178121 APOE_Halo_C_allele APOE Halo Alzheimer's Michael Ward 178122 TREM2_Halo_N_allele TREM2 Halo Alzheimer's... 178123 HNRNPA1_Halo_C_allele HNRNPA1 Halo ALS Michael Ward 178125 GRN_Halo_C_allele GRN Halo Frontotemporal...178133 PSEN2_Halo_C_allele PSEN2 Halo Alzheimer's Michael Ward 178134 POLG_Halo_C_allele POLG Halo Parkinson's...

  18. Genetic Code Expansion

    Type
    Collection
    ... 160377 pDule-Mb haloTyrRS C6 C6 HaloTyrosine tRNA synthatase M. barkeri Halotyrosine Amino Acids Bacterial...160378 pDule2-Mb haloTyrRS C6 C6 HaloTyrosine tRNA synthatase M. barkeri Halotyrosine Amino Acids Bacterial...pylRS nitroY/haloY-F5 PylRS M. alvus 3-nitrotyrosine (3-nitro-Y), 3-halotyrosine (3-halo-Y) Bacterial ...barkeri Mammalian Ryan Mehl 141174 pAcBac1-haloTyrRS C6 C6 HaloTyrosine tRNA synthatase E. coli Mammalian Ryan...Because there are no free codons, this can be challenging. In E.coli , the rarest codon is the amber stop...Peter Schultz 48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian..._4xEcoLeuT(CUA)_AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian...

  19. Validated gRNA Sequences

    Type
    Collection
    ...26355004 Mendenhall CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1...26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-...26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes 26355004 Mendenhall GAL4... Kim BRI1 A. thaliana TTTGAAAGATGGAAGCGCGG cut S. pyogenes 26479191 Kim BRI1 A. thaliana TGAAACTAAACTGGTCCACA...TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM H. sapiens TGAATTGGGATGCTGTTTTT 58779 cut... pyogenes 23792628 Joung ETC2, TRY, and CPC A. thaliana 71288 cut S. pyogenes 26193878 Chen FANCF H. sapiens... 49772 cut S. pyogenes 24112467 Kamoun PDS3 A. thaliana GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339...

  20. Biosensor AAV Preps

    Type
    Collection
    ...Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1...Schreiter Calcium Sensor: HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1...jRGECO1 sRGECO Far-Red/NIR Calcium Sensors HaloCaMP1a HaloCaMP1b NIR-GECO Acetylcholine Sensors iAChSnFR ...Sensors 209655 pAAV.CAGFLEX.(cyto).iATPSnFR2.S29W.A95K.HaloTag CAG iATPSnFR2 none Constitutive 5 Brown , ...
Showing: 1 - 20 of 429 results