We narrowed to 19 results for: hiv gag pol
-
TypeBlog Post...plasmid and a packaging plasmid encoding HIV proteins gag, pol, rev, and tat. 3rd generation systems require...number of HIV genes required for virus production (3 or 4). Third-generation vectors contain gag, pol, and ...gamma-retroviruses use the same genes for packaging (that's gag, pol, and env), the isoforms of these proteins, as ...plasmid, and two packaging plasmids, one encoding gag and pol and a second encoding rev. Secondly, 3rd generation...systems have been developed over the years based on HIV-1; however, the 1st-generation vectors are never ...E1A, which has been shown to repress expression of HIV-1 LTRs (more information is available here). 2nd...a chimeric 5'LTR removes the requirement for the HIV Tat protein, thus decreasing the probability of creating...
-
Lentivirus Plasmids
TypeCollection...Scharenberg 12251 pMDLg/pRRE 3rd Packaging Contains Gag and Pol; can be used with 3rd generation transfer plasmids... Rev Trono 12260 psPAX2 2nd Packaging Contains Gag, Pol, Rev, and Tat; can be used with 2nd and 3rd generation...Trono 12263 pCMV delta R8.2 2nd Packaging Contains Gag, Pol, Rev, and Tat; can be used with 2nd and 3rd generation...Weinberg 8455 pCMV-dR8.2 dvpr 2nd Packaging Contains Gag, Pol, Rev, Tat, Vif, and Nef; can be used with 2nd ...plasmid Kasparov 22500 pNHP 2nd Packaging Contains gag, pol, tat, rev Kasparov 1732 pCPRDEnv 2nd Packaging...Packaging part of the FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco N/A Envelope Ecotropic...Reiser 17531 pCD/NL-BH*DDD 2nd Packaging Contains Gag/Pol, Tat, Rev. Use with envelope plasmids from Jakob... -
Lentiviral Vector Uses and Overview
TypeBlog Post...(Figure 2). The HIV genes that do remain are very important for viral production: Gag (structural precursor... plasmids: one encoding Rev and one encoding Gag and Pol, increasing the number of recombination events...precursor protein), Pol (polymerase), Tat (viral transactivator for transcriptional activation from the ...Trono and collaborators turned to the lentivirus HIV-1, well-known to infect non-dividing cells. The first...plasmids. The packaging plasmid carried a mutated HIV-1 provirus that couldn’t package itself due to a ...plasmid encoded the desired transgene flanked by HIV-1 long terminal repeats (LTRs) that facilitate viral...wide infectivity, is often used as a substitute for HIV-1 Env, which can only infect CD4+ cells. 3rd generation... -
Viral Vectors 101: Gamma-Retroviral Packaging Systems
TypeBlog Post...Packaging genes (viral Gag-Pol): Gag is a structural precursor protein, and Pol is a polymerase. Envelope gene...γ-retroviruses use the same gene products for packaging (Gag, Pol, and Env), the isoforms of these proteins, as ...utilizes a packaging cell line that stably expresses Gag-Pol and/or Env, eliminating the need to deliver these...Garry Nolan at Stanford (Swift, 2001) contains Gag-Pol and either an ecotropic envelope, Phoenix-ECO, ...days. Another variant, Phoenix-gp, contains only Gag-Pol and enables additional flexibility in pseudotyping...lentiviruses and standard γ-retroviruses use the Gag, Pol, and Env genes for packaging; however, they are...different genomes (MoMLV and MSCV for γ-retrovirus; HIV for lentivirus). Additionally, γ-retroviruses can... -
Quick Guide to All Things Lentivirus
TypeBlog Post...because this vector requires only three HIV-1 genes (gag, pol, and rev) for production. Third generation...necessary for the production of a viral particle (Gag, Pol, Tat, Rev and Env) and the transfer plasmid encoding...family including human immunodeficiency virus type-1 (HIV-1), can infect both dividing and non-dividing cells... have been devoted to develop efficient and safe HIV-1-derived lentiviral vectors due to their ability...the desired gene (transfer vector plasmid), 2) the HIV-1 genome containing all viral genes with the exception...lentiviruses (RCL) especially if you are working on HIV positive human cell from the clinic. The 2nd generation...similar to the first one with the exception that the HIV accessory proteins that are not essential for the... -
Viral Vectors 101: The Retroviral Lifecycle
TypeBlog Post... RT and IN incorporated into HIV-1 particles independently of the Gag/Pol precursor protein. The EMBO ...Gamma-retrovirus genome (left) and an HIV lentiviral genome (right.) HIV seems an unlikely candidate for...Retroviridae (commonly called retrovirus) family — of which HIV is a member — may seem like an unlikely candidate...subclass of retroviruses called the lentiviruses (like HIV-1) — that have been developed into lentiviral vectors... cause cancer via insertional mutagenesis (which HIV does not do). Furthermore, molecular biologists working...viral vector particles are made while missing the polymerase gene may seem like a mystery. But it’s simple... M., & Bishop, J. M. (1973). RNA-directed DNA polymerase of Rous sarcoma virus: Initiation of synthesis... -
15 Years of Addgene: The Top 15 Plasmids
TypeBlog Post...from the Didier Trono lab that expresses the HIV gag, pol, rev, and tet genes. It can be used with 2nd...plasmid from the Trono lab that contains the gag and pol genes. It also requires pRSV-Rev and the envelope... -
Viral Vectors 101: Integrase-Deficient Lentiviral Vectors
TypeBlog Post...plasmid contains Gag, Pol, Rev, and Tat genes. Specifically for our knowledge here, the Pol gene encodes ...were first discovered by researchers investigating HIV integrase mutants in the early 1990s (Leavitt et ..., Berry, C., Ecker, J. R., & Bushman, F. (2002). HIV-1 integration in the human genome favors active genes...19491821 PubMed Central PMCID: PMC2835240 Wu Y. (2004). HIV-1 gene expression: lessons from provirus and non-... -
Plasmids 101: Terminators and PolyA signals
TypeBlog Post...constitutive RNA transport element lead to enhanced HIV-1 Gag expression in a context-dependent manner. Nucleic... both polyadenylation and termination. Out of those listed, the SV40 late polyA and rbGlob polyA are thought...any 3’ regulatory elements, such as the polyadenylation or poly(A) signal. While many studies focus on ...purpose and mechanism of polyadenylation vary across cell types, but polyadenylation generally serves to promote...consensus sequence for the addition of a poly(A) tail, the addition of a poly(A) tail on a prokaryotic transcript... termination and polyadenylation Unlike prokaryotes that have a single RNA polymerase for transcription...transcription, eukaryotes have three RNA polymerases (Polymerases I, II, and III), each responsible for transcribing... -
Plasmids 101: Using Transposons in the Lab
TypeBlog Post...replication. They contain two genes: gag and pol. The pol polyprotein encodes the reverse transcriptase ...sites. This is similar to how retroviruses, like HIV, replicate. Class I TEs do not encode a transposase...reading frames (ORFs) which often terminate with a poly(A). ORF2 encodes endonuclease and reverse transcriptase... -
Antibodies 101: Single Chain Fragment Variables (scFvs)
TypeBlog Post... the prevention or treatment of HIV infection. Current Opinion in HIV and AIDS 10:190–197 . https://doi.org...could be useful for delivering scFvs that inhibit HIV. References and Resources References: Ahmad ...recombinant antibody. They are ~25 kDa single polypeptides that contain the variable light chain (VL) and...When these molecules, called Bispecific T-cell engagers (BiTE®s), bind CD3 on T cells and a tumor-specific... -
Lentiviral Vector Guide
TypeGuide...One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag/pol and another encoding...BioRender.com. All retroviruses use the packaging genes gag , pol , and env to create viral particles. Wild-type...Packaging plasmid — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated...and wild-type LTRs Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env...chimeric 5’ LTR) Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid...nuclear export. Provided by a separate plasmid from gag/pol in third-generation packaging plasmids. tat in ...lentivirus include Human immunodeficiency virus (HIV), bovine immunodeficiency virus (BIV), and feline... -
Gamma-Retroviral Vector Guide
TypeGuide...integration. Wildtype gamma-retroviruses contain the gag , pol , and env genes necessary for gamma-retroviral...gamma-retroviral vectors use the common packaging genes gag , pol , and env . The LTRs flank all of these required...Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging gene env...cell lines have been engineered to stably express gag-pol and/or env , eliminating the need to deliver these...Garry Nolan at Stanford. These cell lines contain gag-pol and either an ecotropic envelope, Phoenix-ECO (...days. Another variant, Phoenix-gp, contains only gag-pol and enables additional flexibility in pseudotyping...cell transduction Murine Leukemia Virus (MuLV) and HIV glycoprotein — CD4+ cell transduction Pseudotyped... -
With an Eye Towards the Future, We Look Back at the March for Science
TypeBlog Post...He studies viruses including HIV and is interested in global health policy. He is also chair of the postdoctoral... scientists must rise up and become more politically engaged. I was proud to be a part of a community ...approach policy makers take in abusing climate science skepticism to promote harmful policies that benefit...move slowly, news about possible broad changes to policies seems to break everyday. Many researchers and ...participation in government, evidence to inform policies, a protected place to work, funding for science...medicines, technologies, defense, and governing policies are developed primarily by wishful thinking. The...rains, it was weather befitting of the ominous political climate in which American scientists find themselves... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...an environment (e.g. BL2+) suitable for handling HIV-derivative viruses. For transient knockdown of protein...μg/mL polybrene. TIP: Polybrene increases the efficiency of viral infection. However, polybrene is toxic...drives RNA Polymerase III transcription for generation of shRNA transcripts. cPPT Central polypurine tract,...especially repeated Ts because polyT is a termination signal for RNA polymerase III. Note that these were ... sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense... for 12-15 hours. c. In polypropylene microfuge tubes (do NOT use polystyrene tubes), make a cocktail .... Hexadimethrine Bromide (Polybrene) Prepare a 1mg/mL solution of polybrene (Sigma-Aldrich catalog #H9268... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post... and surveyor. Q15: I used DNA polymerase Takara Ex Taq™ DNA Polymerase for my genomic PCR, but couldn't...In our hands, Herculase II Fusion polymerase or Kapa Hifi Polymerase work very well. Some groups have ...your HR by doing Restriction Fragment Length Polymorphism (RFLP) (see Figure 4 of the Cong et. al (2013...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ...10.1016/j.cell.2011.06.019 Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F...10.1016/j.cell.2013.04.025 Yang, H., Wang, H., Shivalila, C. S., Cheng, A. W., Shi, L., & Jaenisch, R. ... -
CRISPR Guide
TypeCollection...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ... Katz, Y., Theunissen, T. W., Rangarajan, S., Shivalila, C. S., Dadon, D. B., & Jaenisch, R. (2013). Multiplexed..., 290–296. PMID: 32217751 Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford... -
The Challenges of Cell Culture
TypeBlog Post...sharing cells: the black market of cell biology. Engaging in this practice would seem to save time and money...whether the cell lines had isoenzymes and genetic polymorphisms specific to their origins. This technique is..., HeLa cells, and cell culture contamination." Archives of pathology & laboratory medicine 133.9 (2009... -
CRISPR Guide
TypeGuide...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ... Katz, Y., Theunissen, T. W., Rangarajan, S., Shivalila, C. S., Dadon, D. B., & Jaenisch, R. (2013). Multiplexed..., 290–296. PMID: 32217751 Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...