We narrowed to 33 results for: id numbers
-
TypeBlog Post...plasmids. All plasmids at Addgene have unique ID numbers associated with them, which serve as unique PIDs... contain the Addgene ID # and the information necessary to indicate that this ID is managed by Addgene... to wasted time or retractions. Using a catalog number for identifying a reagent can be helpful, but it...online. Furthermore, if the link between the catalog number and reagent description is lost (e.g. a supplier...supplier is bought out by another company and catalog number changes) the original identifier loses its meaning... PIDs within the Addgene catalog. These IDs allow you to unmistakably identify a plasmid available through...about each plasmid item. Given a specific Addgene ID # listed in a publication, you can quickly pull up...
-
Increasing Your Work's Visibility with Addgene: Citation, Search, and Collections
TypeBlog Post...request that you cite it using both its Addgene ID number as well as the reference for its original publication...plasmid from Addgene using its unique Addgene ID number, your publication will be listed on our website... can search for plasmids by name, PI, Addgene ID number, or keyword. Although an initial search might ...- While it is tempting to rely on the citation number when comparing two plasmids, we recommend reviewing...in the repository, our scientists have curated a number of special collections pages. These pages serve... -
Introducing Addgene's New Search - Find Plasmids More Easily For Your Research!
TypeBlog Post...able to include specific plasmid ID numbers. If you know the ID number for a plasmid, your straightforward...our own CSO. But what if you don’t have plasmid ID numbers, or you aren’t sure if any plasmids from a paper...potential results. Just as in the previous layout, the number of plasmids matching each filter is displayed in... Only see plasmids with more than the indicated number of requests Availability to Industry: Restrict ... associated plasmids through the article’s PubMed ID (PMID) ...or DOI Or get some keywords close enough... -
Tips from the Repository Trenches: Using Barcodes to Track Samples
TypeBlog Post...been barcoded with a unique ID number (1D barcode as shown below). This number ensures that every sample...lab ensure that sample ID’s are unique, consistently labeled, and that numbers are not switched around... deposits is received in the lab, although this number fluctuates throughout the year (see graph below... to 96 tubes (see image below). Each plate has numbers and letters to give coordinates, from A1 through...each plasmid so that we never run out. There are a number of different strains of E. coli that can be used...barcode to the container holding the tubes and use this ID to name the corresponding Excel sheet.3. Be specific... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...the plasmids in the library in a single tube. The number of unique plasmids in a pooled library can range...us at [email protected]. Include your deposit number and which data needs to be updated. When your plasmids...entering the data. This step associates an Addgene ID with your plasmids, and adding all the plasmids at...likelihood that the plasmids are given sequential IDs. Name – we encourage the use of descriptive plasmid...include the total size of the insert and the GenBank ID associated with your insert. Pro Tip! If the correct...and the vector type. Pro Tip! Reference the Addgene ID in the "Backbone Manufacturer" box for backbones ... Confirmation email from us with a unique Deposit ID. Addgene will send you a package containing instructions... -
pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs
TypeBlog Post... Addgene ID numbers and the reprogramming factors they encode Episomal Plasmid Addgene ID# Encodes ...clinical trials, as it allows access to a larger number of willing participants. While fibroblasts obtained...vitro for several passages to produce an adequate number of starting cells for reprogramming while PBMCs... -
Dos & Don'ts When Publishing a Scientific Manuscript
TypeBlog Post...world of science publishing, and an ever increasing number of journals and publishers to choose from, it gets...needing a subscription to the journal. An increasing number of funding bodies insist that the research data...information on lab resources, such as catalogue numbers and manufacturers’ details for antibodies, plasmids... asked to add an identifier (a bit like a GenBank ID) to all antibodies, animal models, and software tools... -
Viral Genome Sequencing - A One Stop Shop for AAV Identity and Serotype Confirmation
TypeBlog Post...to assess purity. For labs that produce a small number of AAV preparations this level of quality control... viral vector core facilities producing a large number of viral preparations in parallel, there is a very..., Moullier P, Ayuso E, Vandenberghe LH (2017) AAV-ID: A Rapid and Robust Assay for Batch-to-Batch Consistency... -
We're Updating Our Hold for Publication Policy
TypeBlog Post...with the citation and your deposit or plasmid ID numbers and we’ll be happy to update the plasmids to ... -
Lentivirus ddPCR Titration
TypeProtocol...green) and negative (black) droplets Sample ID Plasmid ID Dilution Copies/20 µL RRE (FAM) Copies/20 µL... transducing units and generally represents the number of infectious viral particles. Users may need to...primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244 Reagent ...1600 To calculate the titers, first calculate the number of viruses per cellular genome: Since the cellular... -
Summer SciComm: Preprints
TypeBlog Post...applications. A number of organizations (such as ASAPbio) advocate for preprints, and a growing number of funding...is valuable, modern scientific publishing has a number of drawbacks, especially the increasingly growing...significantly sooner. Plus, authors can include the Addgene ID for their deposited plasmids in the final journal... -
Plasmids 101: A Brief History of Plasmids and an Improved eBook!
TypeBlog Post..., and pUC were developed to provide higher copy number vectors that could be used in these cloning experiments...“plasmid” derived as a hybrid of "cytoplasm" and "id" (Latin for 'it'), as “a generic term for any extrachromsomal... -
The Challenges of Cell Culture
TypeBlog Post...throw them away and thaw a new batch. The exact number of passages can vary between cells lines, as this... broadly recommended that the lower the passage number the better for experiments. This is to ensure the...and Working stocks of cell lines have the passage number recorded on the outside of the vial and in a cryostore...the front of the incubator containing the passage number, cell line, and date, which you complete each time...wishes to use these cells can see their passage number and key details at a glance. You should also monitor...Short Tandem Repeat (STR) profiling can be used to ID the cell line. The same test is so good that it is... -
Common Injection Routes in Mice
TypeBlog Post...Deciding which type of injection to use depends on a number of factors. You have to weigh the pros and cons...what’s being injected, the type of experiment, the number of mice, the potential pain or discomfort of the...Skill required: beginner Intradermal Intradermal (ID) injections occur between the layers of the skin.... -
Supporting Reproducibility with a Connected ELN
TypeBlog Post...is reproducible, and only the highly restricted number of people who can access the ELN have the ability... data repositories Over the past decade or so a number of general purpose repositories have been launched... It’s possible to associate the depositor’s ORCID ID with the deposit, and a DOI is added to the deposit... -
Tips for arabidopsis transformation
TypeBlog Post...inflorescences begin to grow. This will also increase the number of inflorescences overall, which may improve transformation...transgene. You can optionally remove them to reduce the number of non-transformed seeds from the pool you will...https://books.google.at/books/about/Arabidopsis.html?id=IfZAMNPWVk4C&redir_esc=y (Accessed: 21 September ... -
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog Post...efficiency in the transfected cells, we count the number of tag-positive cells (tag ICC) as a percentage...tagging experiments: Retrieve Ensembl Transcript ID(s) of your favourite gene(s) from Ensembl genome ...index.html Design crRNA/ssODN: Using Ensembl Transcript ID(s) as an input query, pick crRNA (guide RNA sequence... -
Lab Automation at Addgene
TypeBlog Post...Handler and we program the handler to fill a specific number of vials with a specific amount of agar. There ...removable parts to fit on the deck of the Biomek. The FXP id also able to do high throughput DNA preps and other... -
Michael J Fox Foundation (MJFF) Plasmid Collection
TypeCollection...Michael J. Fox Foundation Plasmids MJFF has created a number of plasmids for expression of variants of LRRK2...Labs affiliated with MJFF have also generated a number of Shared Research Tools (Link opens in a new window...proteins of interest. Browse or search the table below. ID Plasmid Gene/Insert Mutations Industry Return to ...deposited with Addgene. Browse or search the table below. ID Plasmid Description Gene/Insert Industry PI Return... -
FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution
TypeBlog Post...ions across the axon's membrane: once a certain number of positive ions crosses the cell membrane, a threshold...Biology. New York: W. H. Freeman, 2000. Bookshelf ID: NBK21668. Matsuno-Yagi, Akemi, and Yasuo Mukohata...