Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 20 results
  1. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    .... U6 small RNA expression shRNA From the human U6 small nuclear promoter Constitutive  Murine U6 is ... trying to pick your perfect promoter! Eukaryotic Promoters   Promoter   Primarily used for RNA     .... In practice, the term "promoter" describes the combination of the promoter (RNA polymerase binding site...recognize and bind to specific promoter elements. This means that the promoter present in your plasmid backbone...RNAP II promoter, whereas small RNAs (such as shRNA) are transcribed from the RNAP III promoters. This ...post on viral vector parts. Promoter specificity Aside from choosing a promoter based on type of RNA transcript...cell types or organisms, promoters must be similarly variable. Bacterial promoters only work in prokaryotic...
  2. CRISPR 101: Multiplex Expression of gRNAs

    Type
    Blog Post
    ...sequence downstream of the 7SK, human U6, mouse U6, or human H1 promoters. If you express fewer than four gRNAs...from its own promoter. But that doesn’t mean you have to clone and transfect multiple promoter-gRNA constructs... of pX330, contains humanized wtCas9 and two U6 promoters. To use this plasmid, you simply order oligonucleotides...to three gRNAs. Entry vectors containing the U6 promoter and the gRNA scaffold are provided with the kit...cloning. gRNAs are expressed from two Drosophila U6 promoters. Cas9 must be supplied on a separate plasmid...can I express more than one gRNA from a single promoter using a plasmid like pX330? Unfortunately, the...contain Type IIS restriction sites flanking the promoter-gRNA construct, but with different sequences adjacent...
  3. Zhang Lab CRISPR Page

    Type
    Collection
    ...Truncated MeCP2 promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA...are described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR...sgRNA to a Cre-dependent mouse or sgRNA to a constitutively Cas9-expressing mouse. Described here are AAV... The Cas9 knockin mouse can be purchased from Jackson Labs: Cre-dependent Cas9 mouse Constitutively active...active Cas9 mouse Available plasmids are described below: 61408 : Targeting vector for the mouse Rosa26 locus...tyroxine binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be...within the mouse genome. This plasmid is used as a control for AAV-KPL. #60226 - AAV:ITR-U6-sgRNA(backbone...
  4. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ....org/10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription ... by the RNAi consortium for targeting human and mouse genes. Protocols...shRNAs directed against 15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...PubMed . A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen...
  5. Hot Plasmids - October 2020

    Type
    Blog Post
    ...express hybrid Cas9-Cas12a gRNAs under a single U6 promoter. The paralog and dual-targeting hybrid gRNA library...shown to have a half life of 84 hours in primary mouse embryonic fibroblasts. This fusion protein can be...
  6. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...cycle indicator for mouse embryonic stem cells and a series of inducible promoter constructs. Up to 34...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of...containing a promoter for constitutive (CMV, SV40, SFFV) or inducible (CMV-TO) cDNA expression, sgRNA (U6) expression...
  7. Lentivirus Plasmids

    Type
    Collection
    ...Trono 11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to...silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to... 3rd U6-driven shRNA empty plasmid; includes a stuffer for easy cloning Root 14748 pLKO.3G 3rd U6-driven...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puro resistance. ...
  8. Gersbach Lab CRISPR Plasmids

    Type
    Collection
    ... the H1 promoter. 53187 pmU6-gRNA : Expresses the S. pyogenes sgRNA from the mouse U6 promoter. 53188 ...the human U6 promoter. 53189 ph7SK-gRNA : Expresses the S. pyogenes sgRNA from the 7SK promoter. 53190 pLV...activator VP64. When directed to its target in gene promoters by the sgRNA expressed in trans from pSPgRNA, ...downstream genes. Multiple sgRNAs targeted to the same promoter act synergistically to activate gene expression...
  9. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...gene regulation in the context of the developing mouse retina. To aide in their studies of the regulatory...features and pX458 modifications: replacement of Cbh promoter with EF1alpha addition of mCherry reporter variant...reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids...shuttle plasmids to insert a second guide within a U6-guide cassette. This process is compatible with all...
  10. Cre-lox system

    Type
    Collection
    ...system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the areas in which...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ...inducible - rrTA expression driven by mouse Nkx cardiac enhancer and promoter fragment minimal TetO-CMV Mammalian... PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting promoter none ...inserting promoter none Mammalian Heller 112616 pmTHC TFP and Cre-ERT2 with MCS for inserting promoter none...respectively) and placed under the control of different promoters. Expression of both N and CCre in the same cell...your experiment. You can search the table for the promoter, fusion, or expression system of choice. We also...
  11. Mammalian RNAi Tools

    Type
    Collection
    ...Sabatini 11795 pLL3.7 Expresses shRNA under the mouse U6 promoter; A CMV-EGFP reporter cassette is included ...pLVCT-tTR-KRAB 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2SM2 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hEF-1alpha promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hUbiquitin promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...
  12. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...72598 Expresses shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro...under from the CB promoter pCDH-CB-iCre 72257 Express iCre under from the CB promoter pCDH-CB-FLPe-P2A-...the CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266 ...interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from the CB promoter pCDH-PGK 72268 xpress...phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest from the CMV promoter. WPRE has been ...from the CB promoter pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2...
  13. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al., ...transgenic mouse models and embryonic stem (ES) cells. These vectors, termed RUSH (For ROSA26 U6 short hairpin...known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ... the lab established a dual-color RNAi “sensor” mouse strain in which Cre expression causes the induction...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...the location and distribution of synapses in the mouse brain. Kim et al is utilizing a mammalian GRASP ...
  14. Sequencing Primers

    Type
    Guide
    ...GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...forward primer mPGK-F CATTCTGCACGCTTCAAAAG Mouse PGK promoter, forward primer MSCV CCCTTGAACCTCCTCGTTCGACC...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...
  15. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...the 20-mer is not G. sgRNA expression from the U6 promoter of the pX330 vector is enhanced by the inclusion...each sample and sequence each colony using a U6 promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC...example guides for the intended deletion of Pim1 in mouse ( Mus musculus ; Table 1 , Figure 2A ). NOTE: In...2014. PubMed . Correction of a genetic disease in mouse via use of CRISPR-Cas9. Wu Y, Liang D, ...
  16. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...the gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...continuous expansion of compatible backbones, promoters, and genes available to the community. If you ...
  17. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Yildiz 159787 pGL3-U6-pegRNA_KCNA1-EGFP KCNA1 U6 Episodic ataxia Xiaolong Wang 159788 pGL3-U6-sgRNA_KCNA1-mcherry...190900 pAAV2ss-U6-sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51-7sk-...7sk-Cas9 HTT U6, 7sk Huntington's Nicole Deglon 190902 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's...Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9 HTT GFP U6, EFS Huntington's Nicole Deglon 191487... Other Promoter CMV T7 polH GAL Other Clear Filters Addgene ID Plasmid Name Gene Tags Promoter Disease...78622 pX335_HR_Prnp_3 PRNP U6 Dementia Walker Jackson 78623 pX459_HR_Prnp_3 PRNP U6 Dementia Walker Jackson...MS2)_Prnp_SAM1 PRNP U6 Dementia Walker Jackson 78625 sgRNA(MS2)_Prnp_SAM2 PRNP U6 Dementia Walker Jackson...
  18. CRISPR Guide

    Type
    Collection
    ...Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and gRNA Presence...and targeting these dCas9 fusion proteins to the promoter region results in robust transcriptional repression...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...knockout, activation, and repression for human and mouse genes. Each CRISPR library is different, as libraries...activation and repression libraries will target promoter or enhancer regions. Be sure to check the library...such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB is more effective...
  19. CRISPR Guide

    Type
    Guide
    ...Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and gRNA Presence...and targeting these dCas9 fusion proteins to the promoter region results in robust transcriptional repression...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...knockout, activation, and repression for human and mouse genes. Each CRISPR library is different, as libraries...activation and repression libraries will target promoter or enhancer regions. Be sure to check the library...such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB is more effective...
Showing: 1 - 20 of 20 results