Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 41 - 46 of 46 results

  1. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...specific genomic regions of interest 82613 3xFLAG-dCas9/MSCV-EGFP Expresses 3xFLAG-dCas9 in mammalian cells for...

  3. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Fon-bREACHes-EYFP Flp AND NOT Cre 137158 pAAV-nEF-ChRmine-mScarlet None 137159 pAAV-nEF-Con/Fon-ChRmine-oScarlet ...

  4. Sequencing Primers

    Type
    Guide
    ...primer MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine ...

  5. Retrovirus Guide

    Type
    Guide
    ...derived from MoMLV (Moloney Murine Leukemia Virus) or MSCV (Murine Stem Cell Virus) sequences. Packaging genes...viruses were derived from different genomes (MoMLV and MSCV for γ-retrovirus; HIV for lentivirus). Additionally...
Showing: 41 - 46 of 46 results