Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 2 of 2 results
  1. Qi Lab CRISPR Page

    Type
    Collection
    ... targeting repetitive sequence of human MUC4 exon 3 46915 pU6-sgGAL4-1 Human pSico-based U6 vector containing...) that contains dCas9 fused to N 51025 pSLQ1661-sgMUC4-E3(F+E) Lentiviral vector that contains sgRNA targeting...
  2. Validated gRNA Sequences

    Type
    Collection
    ...ATGAGAATCAAGGCGGTCGA 62715 cut S. pyogenes 25527740 Bleris MUC4 H. sapiens GTGGCGTGACCTGTGGATGCTG 51025 visualize...
Showing: 1 - 2 of 2 results