Skip to main content

We narrowed to 15 results for: nanoLuc

Showing: 1 - 15 of 15 results
  1. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...codon-optimized Firefly luciferase genes (e.g., luc2), and NanoLuc® Luciferase are available from the repository. ...Afterall, isn’t science better when we share? NanoLuc® Luciferase-based tools are fantastic examples ... can accelerate your research. The creation of NanoLuc® Luciferase from a rather dull 19kDa Oplophorus...fluorescent proteins to make better biosensors. NanoLuc®-fluorescent protein fusions for imaging Fluorescent...administration of the furimazine substrate for NanoLuc luciferase. Both GpNLuc and OgNLuc BRET reporters...the authors noted how CyOFP1 could be excited by NanoLuc® luciferase (NLuc) and set about to create an in...cellular proteins. BRET-based biosensors utilizing NanoLuc® luciferase Many intracellular sensors of events...
  2. Fluorescent Proteins 101: Luciferases

    Type
    Blog Post
    ... engineered a variety of improved luciferases. NanoLuc® Luciferase is the best known: it’s derived from...gracilirostris) Natural 455 19 Coelenterazine None Yes NanoLuc®(derived from Oplophorus gracilirostris) Engineered...Promega Plasmid Collection, including tools using NanoLuc®, NanoBiT, and more. Which luciferase and assay...Imaging with Nano-lanterns  Technologies Enabled by NanoLuc® Luciferase Fluorescent Proteins 101: Introduction...
  3. Luciferase Plasmid Collection

    Type
    Collection
    ...Bryan Welm 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Taipale 87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning... Taipale 87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Oskar Laur 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Javier Alcudia 113442 pcDNA3.1 NL NanoLuc® CMV Mammalian expression of Nanoluc with a N-terminal Myc tag Erich...Rudolf Jaenisch 113450 pLenti NL NanoLuc® Ubc Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich...the acceptor. LumiFluors: EGFP-NanoLuc ( GpNLuc ) and LSSmOrange-NanoLuc ( OgNLuc ) fusions for BRET-based...
  4. Promega Plasmid Collection

    Type
    Collection
    ...high-throughput screening in drug discovery. NanoLuc Fusions NanoLuc (Link opens in a new window) is a 19.1 ...analysis and fusion vectors containing tags such as NanoLuc, HaloTag, SmBiT, and LgBiT, useful for detecting...detecting and tracking proteins using tags such as NanoLuc, HaloTag, SmBiT, and LgBiT. Ordering & Availability... or tag, such as "NFAT", "luciferase", "Ras", "NanoLuc", "HaloTag", "BiT", or other terms. Or search the...range of applications. The technology includes NanoLuc, HaloTag, SmBiT, LgBiT, HiBiT, and more. Luciferase...sensitive detection at endogenous expression levels. NanoLuc fusions are useful for both intracellular and extracellular...mammalian cells, and cell-free systems. NanoBiT Assays NanoLuc Binary Technology (NanoBiT) (Link opens in a new...
  5. Hot Plasmids: Winter 2025

    Type
    Blog Post
    ...biosensor consists of a YFP-tagged G protein and a NanoLuc® (Nluc) Luciferase-fused detector that specifically...
  6. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...
  7. Distribution to Industry

    Type
    Collection
    ...Ordering and MTA Information Featured Collections NEW NanoLuc and HaloTag Fusions from Promega COVID-19 SARS-...
  8. Bacterial Expression Systems

    Type
    Collection
    ...Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors Chromoproteins...
  9. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Corporation 237172 EIF2AK2(252-551)-NanoLuc Fusion Vector EIF2AK2 NanoLuc CMV VWM disease Promega Corporation... Arrowsmith 211083 pNLF1-C_EIF2B2:1-351 EIF2B2 NanoLuc CMV VWM, CACH Cheryl Arrowsmith 211112 pBiT3.1-...
Showing: 1 - 15 of 15 results