Skip to main content

We narrowed to 20 results for: puromycin selection marker

Showing: 1 - 20 of 20 results
  1. Plasmids 101: Shuttle Vectors

    Type
    Blog Post
    ...experiment Selection Once a plasmid is delivered to your target cells, you still need to select for the ...species! Auxotrophic selection Another option is to use a different method of selection entirely. Auxotrophic...the auxotrophic cells die. Some auxotrophic selection markers can be used across species, for example, in...spontaneously develop resistance to selection toxins. Auxotrophic selection is useful for producing stable ...reporters might be used as markers for automated cell sorting or to visually select cells in a microscopy ...planned for vector replication and encoded a selectable marker for both your target systems. But will your...species-compatible promoter for expressing your selectable marker. Otherwise, you could end up killing bacteria...
  2. Plasmids 101: Knockout/Knock-In Plasmids

    Type
    Blog Post
    ...commonly used for positive selection. While the positive selection marker selects for recombination, the ...by homology arms. The negative selection marker HSV-tk is used to select against random recombinants. ...resistance gene and then a counter selection for the negative selection marker - this latter step will kill ...the negative selection marker selects against improper, random recombination into a different locus. Correctly...negative selection marker, but cells with random recombination may incorporate the negative selection marker...positive selection, but it will be sensitive to negative selection. Remove the positive selection marker...randomly integrated into the genome, a negative selection marker like the HSV thymidine kinase (HSV-tk) is included...
  3. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...can use a selection marker to select transfected cells (for example, plasmid with a puromycin resistance...your HR template has a selection marker such as puromycin, you can (also) select for the positive colonies...might still be okay if you are introducing a selection marker gene. The homology arms should be no more ...colonies by puromycin selection. You could then confirm this purification by performing a genotyping assay...sequence. Because the 'NGG' of the PAM is used to select your genomic target, you need to make sure the ... in your target guides, test run them, and then select the best guide to co-transfect in HR donor. Alternatively...reference is Ran et al. (2013). As for target selection, we usually pick 3–6 guides around the region ...
  4. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ...desired genetic tag and marker sequence into the targeted loci. The selectable marker can be removed by Cre-mediated...endogenous genes and simultaneously introduce a selection marker for screening modified strains. With SapTrap...) and nonfluorescent (Halo, SNAP) tags, a selectable marker (floxed Cbr-unc-119) for easy screening of... donor plasmids with SapI allows the tag, selectable marker, and connector to be released (Fig. 1, Step...Strep, TEV-V5) with either blasticidin or puromycin selection. Researchers at the Allen Institute for Cell... a collection of plasmids to fluorescently tag markers of cellular structures in mammalian cells. These...
  5. Lentivirus Plasmids

    Type
    Collection
    ...empty plasmid with puromycin selection. See plasmid 24150 for hygromycin selection. Bob Weinberg 10878...expression of shRNA with puromycin selection. See plasmid 21916 for neomycin selection. Dmitri Wiederschain...expression of shRNA with neomycin selection. See plasmid 21915 for puromycin selection. Dmitri Wiederschain 36084...shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. Christophe Benoist and Diane...or miRNAs, and use a wide variety of drug selection markers. See Campeau et al. (2009) for additional ...pLenti-puro 3rd CMV-driven expression of cDNA with puromycin selection. Ie-Ming Shih 25737 pSLIK-Hygro 3rd Tet-based...lentiviral expression, TRE-gateway, with puromycin selection. See Root Lab pLEX and pLIX Gateway backbones...
  6. Plasmids 101: Mammalian Vectors

    Type
    Blog Post
    ...scientsts do not "select" for cells that have taken up the plasmid in the same way. Selection methods, described...Positive selection in mammalian cells To achieve stable transfection, there should be a selective pressure...table below we focus on positive selection; however, negative selection techniques can be used in conjunction...the most commonly used selection markers are listed below: Name Gene Conferring Resistance Cell Types... including how replication occurs and whether selection is necessary for transfected cells. Before getting...cell lines and are not used for general plasmid selection. Instead, reporter genes are often employed to...purposes of this post, we will define positive selection as the means of picking up positive traits (i....
  7. Sleeping Beauty Awakens for Genome Engineering

    Type
    Blog Post
    ... variants with different selection markers (blasticidin, neomycin, puromycin, hygromycin) and fluorescent...fused to a region of the RPL41 gene, to drive the selection/reporter parts of each construct. This new tool...
  8. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...backbone to encode the CD90.1 selection marker, Thy1.1, in addition to puromycin resistance.  The MYC-CRISPR...New GRAB-DA and 5HT sensors New AAV tools to selectively control parvalbumin interneurons from the Dimidschstein...
  9. Retrovirus Plasmids

    Type
    Collection
    ...See plasmid 1771 for puromycin selection, and plasmid 1774 for neomycin selection. Bob Weinberg 10676 ...) MSCV For cloning and gene expression. Select with puromycin or screen for GFP. David Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE...expression with GFP expression. See plasmid 8452 for puromycin resistance. William Hahn 63704 pRetroX GFP T2A...MSCV-IRES-GFP MSCV For transgene expression with a GFP marker. Tannishtha Reya 21654 pMSCV PIG (Puro IRES GFP...
  10. Lentiviral Prep Service

    Type
    Collection
    ... Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries 73178 Human... genes along with 1000 non-targeting controls Puromycin John Doench , David Root 73179 Human gRNA library... genes along with 1000 non-targeting controls Puromycin John Doench , David Root 247026 Human sgRNA library...genes along with 1,000 non-targeting controlss Puromycin John Doench , David Root 247027 Human sgRNA library...genes along with 1,000 non-targeting controls Puromycin John Doench , David Root Human activation pooled...56,762 unique sgRNAs targeting 18,885 human genes Puromycin John Doench , David Root Human inactivation pooled...human genes along with 500 non-targeting controls Puromycin John Doench , David Root 92386 (Discontinued) ...
  11. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... with G418 selection Find nematode transgenesis plasmids with Neomycin selection Puromycin Mammalian pcDNA3.1...function, selectable markers, and more. Plasmid...site (MCS), an inducible promoter, and/or a selectable marker. They are frequently used in molecular biology...Genome Modification, mRNA Regulation, and More Selectable Markers Species-Specific Expression If you want to...retroviral gene expression with GFP or mCherry selectable marker pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP - For retroviral...the Tet-On or Tet-Off system Return to top Selectable Markers Regardless of your delivery method, it's ...Thus, many plasmids have markers on them so that you can find or select for only the cells that received...
  12. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Promoter Selectable Marker PI Publication Return to top Empty Prime Editing gRNA Vectors A selection of empty...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Bacteria ID Plasmid... Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Drosophila ID Plasmid Gene...Gene/Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter... epegRNA, nicking sgRNA), cloning enzyme, selectable marker, and whether the plasmid contains Cas9. ID...Guide RNA Type Cloning Enzyme Co-expressed Cas9 Selection PI 132777 pU6-pegRNA-GG-acceptor Mammalian hU6...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...
  13. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection. Figure ... drives expression of puromycin. Puro R Puromycin resistance gene for selection of pLKO.1 plasmid in mammalian...differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration...expression of the puromycin resistance gene. f. To select for infected cells, add puromycin to the media at...positive control for the puromycin selection. Days 4+: g. Change to fresh puromycin-containing media as needed... the optimal puromycin concentration F.3 Protocol for lentiviral infection and selection G. Safety H. ... target selection are continuously being improved. Below are suggestions for target selection. Use an ...
  14. Tetracycline Inducible Expression

    Type
    Collection
    ...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri...design of inducible shRNA expression, with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid...article ( Kowarz et al., 2015 ) for additional selection markers. rtTA-Advanced Tight TRE Eric Kowarz 96930...expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521...vector with blasticidin selection. See Plasmid #26730 for hygromycin selection. rtTA3 Eric Campeau 128061... Plasmid #85972 for hygromycin selection. TetR H1-2O2 Cindy Miranti 104321 tet-pLKO-sgRNA-puro Lentiviral...vector for repressible expression with blasticidin selection. *Note: this vector contains an insert (MAT2A)...
  15. Colony Formation Titering Assay

    Type
    Protocol
    ...adapted to a variety of target cell lines and selection markers. Note this assay requires staining resistant...were treated with puromycin. Colonies were allowed to grow in the presence of selective reagent for 12 days... 2: Replace media with fresh media containing selection reagent Days 3–14: Change media as needed Days...media exchanges every 3–4 days. After 12 days of selection, no cells have survived in the untransduced well...
  16. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with custom-cloned ...a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...Curie in Paris, has developed the retention using selecting hooks (RUSH) system. How does it work? RUSH is...proteins (FPs). A subpopulation of mitochondria is selectively labeled by irradiating the photoactivatable FP... fusion proteins have been used as subcellular markers to visualize the dynamics and interactions between...and endosomes. These fusion proteins can act as markers for visualization of subcellular structure, for...
  17. Sequencing Primers

    Type
    Guide
    ...promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Forward...3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance...
  18. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...gamma-retroviral vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic...Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells ...& Burgess, S. M. (2014). MLV integration site selection is driven by strong enhancers and active promoters...
  19. Lentiviral Vector Guide

    Type
    Guide
    ...type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead... Many lentiviral vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic...Instead of selection by an antibiotic, fluorescence-activated cell sorting (FACS) is used to sort cells ...
Showing: 1 - 20 of 20 results