Skip to main content
Addgene

We narrowed to 22 results for: puromycin selection marker

Showing: 1 - 20 of 22 results
  1. Plasmids 101: Shuttle Vectors

    Type
    Blog Post
    ...experiment Selection Once a plasmid is delivered to your target cells, you still need to select for the ...species! Auxotrophic selection Another option is to use a different method of selection entirely. Auxotrophic...the auxotrophic cells die. Some auxotrophic selection markers can be used across species, for example, in...spontaneously develop resistance to selection toxins. Auxotrophic selection is useful for producing stable ...reporters might be used as markers for automated cell sorting or to visually select cells in a microscopy ...planned for vector replication and encoded a selectable marker for both your target systems. But will your...species-compatible promoter for expressing your selectable marker. Otherwise, you could end up killing bacteria...
  2. Plasmids 101: Knockout/Knock-In Plasmids

    Type
    Blog Post
    ...commonly used for positive selection. While the positive selection marker selects for recombination, the ...by homology arms. The negative selection marker HSV-tk is used to select against random recombinants. ...resistance gene and then a counter selection for the negative selection marker - this latter step will kill ...the negative selection marker selects against improper, random recombination into a different locus. Correctly...negative selection marker, but cells with random recombination may incorporate the negative selection marker...positive selection, but it will be sensitive to negative selection. Remove the positive selection marker...randomly integrated into the genome, a negative selection marker like the HSV thymidine kinase (HSV-tk) is included...
  3. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...can use a selection marker to select transfected cells (for example, plasmid with a puromycin resistance...your HR template has a selection marker such as puromycin, you can (also) select for the positive colonies...might still be okay if you are introducing a selection marker gene. The homology arms should be no more ...colonies by puromycin selection. You could then confirm this purification by performing a genotyping assay...sequence. Because the 'NGG' of the PAM is used to select your genomic target, you need to make sure the ... in your target guides, test run them, and then select the best guide to co-transfect in HR donor. Alternatively...reference is Ran et al. (2013). As for target selection, we usually pick 3–6 guides around the region ...
  4. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ...desired genetic tag and marker sequence into the targeted loci. The selectable marker can be removed by Cre-mediated...endogenous genes and simultaneously introduce a selection marker for screening modified strains. With SapTrap...) and nonfluorescent (Halo, SNAP) tags, a selectable marker (floxed Cbr-unc-119) for easy screening of... donor plasmids with SapI allows the tag, selectable marker, and connector to be released (Fig. 1, Step...Strep, TEV-V5) with either blasticidin or puromycin selection. Researchers at the Allen Institute for Cell... a collection of plasmids to fluorescently tag markers of cellular structures in mammalian cells. These...
  5. Plasmids 101: Mammalian Vectors

    Type
    Blog Post
    ...scientsts do not "select" for cells that have taken up the plasmid in the same way. Selection methods, described...Positive selection in mammalian cells To achieve stable transfection, there should be a selective pressure...table below we focus on positive selection; however, negative selection techniques can be used in conjunction...the most commonly used selection markers are listed below: Name Gene Conferring Resistance Cell Types... including how replication occurs and whether selection is necessary for transfected cells. Before getting...cell lines and are not used for general plasmid selection. Instead, reporter genes are often employed to...purposes of this post, we will define positive selection as the means of picking up positive traits (i....
  6. Sleeping Beauty Awakens for Genome Engineering

    Type
    Blog Post
    ... variants with different selection markers (blasticidin, neomycin, puromycin, hygromycin) and fluorescent...fused to a region of the RPL41 gene, to drive the selection/reporter parts of each construct. This new tool...
  7. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...backbone to encode the CD90.1 selection marker, Thy1.1, in addition to puromycin resistance.  The MYC-CRISPR...New GRAB-DA and 5HT sensors New AAV tools to selectively control parvalbumin interneurons from the Dimidschstein...
  8. Lentiviral Prep Service

    Type
    Collection
    ... Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries 73178 Human... genes along with 1000 non-targeting controls Puromycin Doench , Root 73179 Human gRNA pooled library ... genes along with 1000 non-targeting controls Puromycin Doench , Root Human activation pooled libraries...56,762 unique sgRNAs targeting 18,885 human genes Puromycin Doench , Root Human inactivation pooled libraries...human genes along with 500 non-targeting controls Puromycin Doench , Root 92386 Human CRISPR inhibition library...human genes along with 500 non-targeting controls Puromycin Doench , Root Mouse knockout pooled libraries ... genes along with 1000 non-targeting controls Puromycin Doench , Root Cas9 Lentivirus Cas9 viruses can...
  9. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection. Figure ... drives expression of puromycin. Puro R Puromycin resistance gene for selection of pLKO.1 plasmid in mammalian...differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration...expression of the puromycin resistance gene. f. To select for infected cells, add puromycin to the media at...positive control for the puromycin selection. Days 4+: g. Change to fresh puromycin-containing media as needed... the optimal puromycin concentration F.3 Protocol for lentiviral infection and selection G. Safety H. ... target selection are continuously being improved. Below are suggestions for target selection. Use an ...
  10. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... with G418 selection Find nematode transgenesis plasmids with Neomycin selection Puromycin Mammalian Tet-pLKO-puro...function, selectable markers, and more. Plasmid...site (MCS), an inducible promoter, and/or a selectable marker. They are frequently used in molecular biology...Genome Modification, mRNA Regulation, and More Selectable Markers Species-Specific Expression If you want to...retroviral gene expression with GFP or mCherry selectable marker pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP - For retroviral...the Tet-On or Tet-Off system Return to top Selectable Markers Regardless of your delivery method, it's ...Thus, many plasmids have markers on them so that you can find or select for only the cells that received...
  11. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Promoter Selectable Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication... epegRNA, nicking sgRNA), cloning enzyme, selectable marker, and whether the plasmid contains Cas9. ID...Publication Empty Prime Editing gRNA Vectors A selection of empty gRNA vectors suitable for prime editing...Guide RNA Type Cloning Enzyme Co-expressed Cas9 Selection PI 132777 pU6-pegRNA-GG-acceptor Mammalian hU6...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...
  12. Lentivirus Plasmids

    Type
    Collection
    ...inducible expression of shRNA; puromycin selection. See plasmid 21916 for Neo selection. Wiederschain 11578 pSico...shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. Benoist and Mathis 21915 Tet-pLKO-puro...or miRNAs, and use a wide variety of drug selection markers. See article for more variations. Campeau ...-puro 3rd CMV driven expression of cDNA. Puro selection. Shih 25737 pSLIK-Hygro 3rd Tet-based inducible...19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895 pLX301 3rd Gateway plasmid for ...Tet-pLKO-neo 3rd inducible expression of shRNA; neomycin selection. See plasmid 21915 for Puro resistance. Wiederschain...
  13. Tetracycline Inducible Expression

    Type
    Collection
    ...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri...design of inducible shRNA expression, with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid...article ( Kowarz et al., 2015 ) for additional selection markers. rtTA-Advanced Tight TRE Eric Kowarz 96930...expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521...vector with blasticidin selection. See Plasmid #26730 for hygromycin selection. rtTA3 Eric Campeau 128061... Plasmid #85972 for hygromycin selection. TetR H1-2O2 Cindy Miranti 104321 tet-pLKO-sgRNA-puro Lentiviral...vector for repressible expression with blasticidin selection. *Note: this vector contains an insert (MAT2A)...
  14. Colony Formation Titering Assay

    Type
    Protocol
    ...adapted to a variety of target cell lines and selection markers. Note this assay requires staining resistant...were treated with puromycin. Colonies were allowed to grow in the presence of selective reagent for 12 days... 2: Replace media with fresh media containing selection reagent Days 3–14: Change media as needed Days...media exchanges every 3–4 days. After 12 days of selection, no cells have survived in the untransduced well...
  15. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Expression Vectors Select a gRNA expression plasmid based on factors such as selectable marker or cloning method...Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu 45946 pU6-BbsI-chiRNA dU6...
  16. Retrovirus Plasmids

    Type
    Collection
    ...) MSCV For cloning and gene expression; select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE...-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid...
  17. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with custom-cloned ...a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...Curie in Paris, has developed the retention using selecting hooks (RUSH) system. How does it work? RUSH is...proteins (FPs). A subpopulation of mitochondria is selectively labeled by irradiating the photoactivatable FP... fusion proteins have been used as subcellular markers to visualize the dynamics and interactions between...and endosomes. These fusion proteins can act as markers for visualization of subcellular structure, for...
  18. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...plasmid ID 48139), which include GFP and puromycin as selectable markers, respectively, or constructs in which... sgRNA and SpCas9, but does not contain markers for selection 1 . Other constructs may be utilized, such...Screening CRISPR/Cas9 Clones for Deletions and Clone Selection For suspension cells, transfer all clones to a...conditions optimized on the bulk cells (see step 6 ). Select the clones identified with the desired deletion...onto LB agar plates with the relevant antibiotic. Select multiple colonies, mini-prep each one, and subject...initial screen ensures that the correct clone was selected and reproducibility of results. To evaluate the...
  19. Sequencing Primers

    Type
    Guide
    ...forward primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...
Showing: 1 - 20 of 22 results