Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 3 of 3 results

  2. Validated gRNA Sequences

    Type
    Collection
    ...GGAGAAGGTGAAGGACACTG 42246 cut S. pyogenes 23360964 Joung RNF2 H. sapiens GTCATCTTAGTCATTACCTG 47509 cut S. pyogenes...

  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...lipofuscinosis Veerle Baekelandt 171922 pOPINB-hRNF216(457-784) RNF216 His, 3C protease cleavage site T7 Hypogonadotropic...hypogonadism Bernhard Lechtenberg 171923 pOPINB-hRNF216(511-784) RNF216 His, 3C protease cleavage site T7 Hypogonadotropic...neuroaxonal dystrophy Michael Ward 178167 RNF216_Halo_C_allele RNF216 Halo Hypogonadotropic hypogonadism Michael...
Showing: 1 - 3 of 3 results