Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 5 of 5 results

  1. Cre-lox system

    Type
    Collection
    ...CAG Mammalian Miyanari 140760 Sox1(2A-Cre) Cre; Targeting vector for Sox1 locus CAG Mammalian Okano 153207...

  2. Donations from Addgene to Yield Answers for Rare Disease Researchers

    Type
    Blog Post
    ...Wattanasirichaigoon carried different mutations in a gene called SOX10. To understand the functional role of those mutations...cell lines and/or mouse models carrying different SOX10 mutations. More specifically, they’ve proposed to...big progress in elucidating association between SOX10 and WS4 and also several other rare genetic diseases...

  3. Validated gRNA Sequences

    Type
    Collection
    ...23918387 Chen SOX17 H. sapiens GCCCAGCCCGGCCATCACCG 59725 cut S. pyogenes 25543152 Hanna Sox17 H. sapiens...24346702 Wolfe Sox17 H. sapiens GGAGGGGCAAGGGGCGGGCG 50924 activate S. pyogenes 24346702 Wolfe Sox17 H. sapiens...GGGCAAGTACGTCGATTCCA 50926 activate S. pyogenes 24346702 Wolfe Sox17 H. sapiens GGGCGTGGGCCTAACGACGC 50923 activate S...

  5. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TTGTGTGTGTGTGTGTGTgtcagtgagcagcagcTCGCCACAGTGTTGGAGA sox1a TAL3366 & TAL3367 TATAGCATGATGATGGAAacggaccttcattcccCGGGACCCCAAACCAACA...
Showing: 1 - 5 of 5 results