...exposure. Examples include the heat shock-inducible Hsp70 or Hsp90-derived promoters, in which a gene of choice... exposure to a brief heat shock. In the case of Hsp70, the heat shock releases heat shock factor 1 (HSF...

...2075.1984.tb02263.x  Munro S, Pelham HRB (1986) An hsp70-like protein in the ER: Identity with the 78 kd ...

...46294 pBS-Hsp70-Cas9 : A codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter...45945 pHsp70-Cas9 : The codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter...genome alterations can be generated within a month. phsp70-Cas9 and a single chiRNA plasmid can be coinjected...mutations via imperfectly repaired DSBs. Coinjection of phsp70-Cas9 and plasmids encoding two chiRNAs can induce...

...FLJ54328, HSP70-1B, HSP70-2, HSPA1A HSPA1L heat shock 70kDa protein 1-like HSP70-1L, HSP70-HOM, HSP70T, hum70t...FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1, HSP70-1A, HSP70I, HSP72, HSPA1, HSPA1B HSPA1B heat shock 70kDa...protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, RY, hsp70, hsp70RY... protein 6 (HSP70B') - HSPA8 heat shock 70kDa protein 8 HSC54, HSC70, HSC71, HSP71, HSP73, HSPA10, LAP1...

...30524 pCSHSP:Cre heat shock inducible Cre Xenopus hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI...tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus Ryffel 31132 pCSCre Cre CMV Xenopus Ryffel 31309... recombinases that are less toxic in Drosophila hsp70 Insect Rubin 32606 Ttr:Cre Cre expressed in visceral...control Gal1 Yeast Gartenberg 50797 pUAS-Cre Cre UAS/Hsp70 Mammalian Cepko 50935 MSCV-PIG-Cre Cre and GFP coexpression...alpha Lentiviral Jacks 60877 pMAZe Cre and dtomato hsp70 Zebrafish Lewis 60930 pPL5071_TEF1*-Cre_URA3 Cre...See article for more colors. Mammalian Zeng 24334 hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Heat-inducible...

... MSP4-bio 68511 MSP5-bio 68512 MSP7.1-bio 68513 MSP7.6-bio 68514 MSP7.9-bio 68515 MSP10-bio 68516 P12-...

...47732 MSP6-bio 47733 H101-bio 47734 MSP11-bio 47735 MSP7-bio 47736 MSRP1-bio 47737 MSRP2-bio 47738 MSRP3-...

...and cloning; injection protocol pU6-BbsI-chiRNA ; phsp70-Cas9 PDF 106.5 KB Orkin and Bauer Protocol for ...

... 65767 Bacteria BsaI yes, cut S. pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes ...

...primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT...

...Parkinson's Hilal Lashuel 105970 hsp70: mKate2 dynactin1-811 DCTN1 mKate2 hsp70 ALS Caren Norden 105971 pME...