Skip to main content

We narrowed to 23 results for: tetracycline resistance

Showing: 1 - 20 of 23 results
  1. Plasmids 101: A Brief History of Plasmids and an Improved eBook!

    Type
    Blog Post
    ...treated a tetracycline resistant plasmid, pSC101, and a newly developed kanamycin resistant plasmid, pSC102...EPISOME-MEDIATED TRANSFER OF DRUG RESISTANCE IN ENTEROBACTERIACEAE VIII: Six-Drug-Resistance R Factor.” Journal of...other extrachromosomal particles, particularly Resistance or R-factors. Like F-factors, R-factors could... selected for E. coli transformants that were resistant to both. When this proved successful, pSC101 became... PMC314833. Datta, Naomi. “Transmissible Drug Resistance in an Epidemic Strain of Salmonella Typhimurium...
  2. Plasmids 101: Antibiotic Resistance Genes

    Type
    Blog Post
    ...permeability Bactericidal 10-100 ug/mL Tetracycline tetracyclin Binds 30S ribosomal subunit; inhibits...Resistance to antibiotics is a widely used tool in molecular biology, yet scientists rarely stop to think...to maintain the plasmid. Adding an antibiotic resistance gene to the plasmid solves both problems at once...pressure to keep your plasmid. Viva la (bacterial) resistance!  What are antibiotics? Antibiotics are generally...chromosomal level. Scientists introduce an antibiotic resistance cassette within the coding region of the gene...experiments it is best practice not to use the same resistance cassette for the mutation and for plasmid selection... Additionally, scientists can use the loss of resistance as a marker for successful cloning. In these ...
  3. Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

    Type
    Blog Post
    ...replace a gene of interest with an antibiotic resistance cassette.   Substrate DNA Design and Generation... selectable DNA fragments, such as antibiotic resistance genes, as well as non-selectable DNA fragments...lambda red phage, λTetR, that carries the tetracycline resistance gene and the lambda red repressor cI857...confirmation of recombinant clones If a antibiotic resistance gene has been inserted, recombinants can first...first be selected via antibiotic resistance, but all clones should be further tested to confirm the presence...
  4. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    ...ribosome Confers resistance to streptomycin Tn10   Confers resistance to tetracycline Additionally... XL1 Blue Tetracycline Blue/white screening and routine cloning, nalidixic acid resistant. endA1 gyrA96...uptake, iron uptake receptor mutation. T1/T5 Phage resistance gal Mutation in galactose metabolism pathway...only gyrA, gyrA96 DNA gyrase mutation Confers resistance to nalidixic acid  hsdRMS hsdR(rk-, mk+) Unmethylated...Table 2: Lab strains of E. coli Strain Natural resistance Primary Use Genotype ccdB Survival 2 T1R   ...lacIq Δ(lacZ)M15] hsdR17(rK- mK+)  XL10 Gold Tetracycline and Chloramphenicol High competency cloning ...plasmids, ligated DNA, and libraries, nalidixic acid resistant.  endA1 glnV44 recA1 thi-1 gyrA96 relA1 lac Hte...
  5. Plasmids 101: E. coli Strains for Protein Expression

    Type
    Blog Post
    ...coli B strain, except ** which are K12 Strain Resistance Key Features Genotype Use BL21 (DE3)   Basic...not recommended for toxic proteins BL21-A1 Tetracycline Arabinose-inducible expression of T7 RNAP; IPTG...T7RNAP-tetA General protein expression  BLR (DE3) Tetracycline RecA-deficient; best for plasmids with repetative...proteins Origami2 (DE3)** Streptomycin and Tetracycline Contains highly active thioredoxin reductase.... The pLys plasmid contains a chloramphenicol resistance cassette for positive selection and a p15A origin...
  6. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...of its parts. Elements such as the antibiotic resistance gene and the origin of replication are necessary...expression, but may vary by cell type. Tends to resist promoter down regulation due to methylation or ...splice acceptor. TRE General expression mRNA Tetracycline response element promoter Inducible with Tetracyline...promoter with low basal activity and several tetracycline operators. Transcription can be turned on or...
  7. Tetracycline Inducible Expression

    Type
    Collection
    ...Collections Tetracycline (Tet) Inducible Expression Tetracycline (Tet) Inducible Expression Tetracycline Off ...have adapted an antibiotic resistance operon from E. coli : the tetracycline repressor protein (TetR) and...shown. Tetracycline Off (Tet-Off) The first major advance was the Tet-Off system. A tetracycline-controlled...presence of tetracycline, tTA unbinds from the TRE, resulting in reduced gene expression. Tetracycline Off is...binds the TRE in the presence of tetracycline. A new reverse tetracycline-controlled transactivator (rtTA... absence of tetracycline, rtTA is unable to bind the TRE. In the presence of tetracycline, rtTA binds ...applications. Use of Tetracycline or a Derivative Doxycycline, a derivative of tetracycline, is a preferred...
  8. Retrovirus Plasmids

    Type
    Collection
    ... for puromycin resistance. William Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression...cells. See the Weinberg Lab page for additional resistance variants. Bob Weinberg 1773 pBABE-hygro-hTERT...
  9. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...integrative plasmid containing tetracycline repressor TetR and resistance selection marker KanR. This strain... common human pathogen notorious for its high resistance to antibiotics. Several CRISPR/Cas-based systems...abscessus’ high rate of spontaneous antibiotic resistance interfering with selection. Using an inducible...understanding of its biology, pathogenicity, and resistance mechanisms.     Figure 4. Overview of... cassette on a plasmid expressing mCherry and resistance selection marker HygR. The CRISPR system is induced...
  10. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type
    Blog Post
    ..., or other. Bacterial Resistance Enter bacterial antibiotic resistance encoded in the plasmid that...nourseothricin (clonNat), spectinomycin, streptomycin, tetracycline, combinations of the above, or other. High...
  11. Sequencing Primers

    Type
    Guide
    ...of neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene Reverse AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA...
  12. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    ... of shRNA in target cells by the addition of tetracycline/doxycycline to the grown media resulting in ...customizable sgRNA from the U6 promoter and puromycin resistance from the EF-1a promoter. It’s a 3rd generation...
  13. Mouse Modeling, Part 1: Genetically Engineered Mice

    Type
    Blog Post
    ...positive selection marker such as an antibiotic resistance gene is also included to select for successfully... the cell can occur. Similar systems include tetracycline or doxycycline mediated activation of Cre to...
  14. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type
    Blog Post
    .... The absence of a rigid cell wall makes them resistant to antibiotics and antibacterial drugs like penicillin...of antibiotics can allow mycoplasma to develop resistance to the antibiotics. Antibiotics must only be ...prolonged use of a particular antibiotic can induce resistance for other bacteria apart from mycoplasma. Always...fluoroquinolone ciprofloxacin, ciprobay, zagam, baytril, tetracycline, etc. are available for mycoplasma removal from...
  15. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible Expression page Bacteria Lac...attR2); Zea mays Ubi1 promoter and Hygromiycin resistance marker Also see more empty backbones on our Plant...Variant of lentiCRISPR v2 that confers hygromycin resistance pRGEB32 - Express sgRNA/PTG with rice snoRNA ...loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd...
  16. Lentivirus Plasmids

    Type
    Collection
    ...EGFP 3rd CMV-driven EGFP fusion with puromycin resistance. Can be used for cDNA expression. David Sabatini...Sheltzer 20342 FUW-M2rtTA 3rd Contains reverse tetracycline transactivator. Rudolf Jaenisch 131626 pHAGE-mt-mKeima...
  17. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ... carry one or more antibiotic resistance genes, which confer resistance to a specific antibiotic to the... carrying them. The presence of an antibiotic resistance gene on a plasmid allows researchers to easily...mL Kanamycin 50 µg/mL Spectinomycin 50 µg/mL Tetracycline 10 µg/mL Tips and FAQ What is the difference...antibiotic in your LB media matches the antibiotic resistance on your plasmid. If the bacteria on your LB agar...
Showing: 1 - 20 of 23 results