We narrowed to 10 results for: tk
-
TypeBlog Post.../10.7554/elife.38853 Hu C-D, Chinenov Y, Kerppola TK (2002) Visualization of Interactions among bZIP and...://doi.org/10.1016/s1097-2765(02)00496-3 Kerppola TK (2006) Design and implementation of bimolecular fluorescence.... https://doi.org/10.1038/nprot.2006.201 Kerppola TK (2013) Bimolecular Fluorescence Complementation (...
-
Adeno-associated Viruses (AAVs) for Genome Editing
TypeBlog Post...enrichment, whereas pAAV-TK-Acceptor has a conventional heterologous promoter-driven TK-neoR gene. To modify... AAV tagging vectors (pAAV-SEPT-Acceptor and pAAV-TK-Acceptor) so that they can be easily adapted to edit... -
Plasmids 101: Knockout/Knock-In Plasmids
TypeBlog Post... homology arms. The negative selection marker HSV-tk is used to select against random recombinants. ...selection marker like the HSV thymidine kinase (HSV-tk) is included just outside one of the homology arms... -
Luciferase Plasmid Collection
TypeCollection...for normalization. Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion of 5' promoter... luciferase expression under the control of a HSV TK promoter for normalization. Modified from psi-CHECK2... -
A Practical Guide to Optimizing AAV DIO and FLEx Vector Expression
TypeBlog Post..., in a recent study by the Wickersham lab (Lavin, TK. 2020) it was determined that the optimal titer to...664–678. https://doi.org/10.1089/hum.2019.277 Lavin TK, Jin L, Lea NE, Wickersham IR (2020) Monosynaptic... -
Back to Bacteria: CRISPR gRNA Multiplexing Using tRNAs
TypeBlog Post...Nissim L, Perli SD, Fridkin A, Perez-Pinera P, Lu TK. Mol Cell. 2014 May 22;54(4):698-710. doi: 10.1016... -
INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons
TypeBlog Post... A, He C , Xu M, Zhou Z, Smock DC, Tang K, Owens TK, Krishnappa N, Sachdeva R, Deutschbauer AM, Banfield... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...doi.org/10.1093/nar/gkt520 Citorik RJ, Mimee M, Lu TK (2014) Sequence-specific antimicrobials using efficiently... -
Sequencing Primers
TypeGuide...end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA,... -
Optogenetics Guide
TypeGuide...SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, et al. 2014. Independent...