Skip to main content

We narrowed to 10 results for: tk

Showing: 1 - 10 of 10 results
  1. Adeno-associated Viruses (AAVs) for Genome Editing

    Type
    Blog Post
    ...enrichment, whereas pAAV-TK-Acceptor has a conventional heterologous promoter-driven TK-neoR gene. To modify... AAV tagging vectors (pAAV-SEPT-Acceptor and pAAV-TK-Acceptor) so that they can be easily adapted to edit...
  2. Plasmids 101: Knockout/Knock-In Plasmids

    Type
    Blog Post
    ... homology arms. The negative selection marker HSV-tk is used to select against random recombinants. ...selection marker like the HSV thymidine kinase (HSV-tk) is included just outside one of the homology arms...
  3. Luciferase Plasmid Collection

    Type
    Collection
    ...for normalization. Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion of 5' promoter... luciferase expression under the control of a HSV TK promoter for normalization. Modified from psi-CHECK2...
  4. Sequencing Primers

    Type
    Guide
    ...end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA,...
  5. Optogenetics Guide

    Type
    Guide
    ...SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, et al. 2014. Independent...
Showing: 1 - 10 of 10 results