We narrowed to 11 results for: tk

1. Don’t FRET: Bimolecular Fluorescence Complementation Makes Visualizing Protein-Protein Interactions Easy

   Type

   Blog Post

   .../10.7554/elife.38853 Hu C-D, Chinenov Y, Kerppola TK (2002) Visualization of Interactions among bZIP and...://doi.org/10.1016/s1097-2765(02)00496-3 Kerppola TK (2006) Design and implementation of bimolecular fluorescence.... https://doi.org/10.1038/nprot.2006.201 Kerppola TK (2013) Bimolecular Fluorescence Complementation (...

2. Adeno-associated Viruses (AAVs) for Genome Editing

   Type

   Blog Post

   ...enrichment, whereas pAAV-TK-Acceptor has a conventional heterologous promoter-driven TK-neoR gene. To modify... AAV tagging vectors (pAAV-SEPT-Acceptor and pAAV-TK-Acceptor) so that they can be easily adapted to edit...

3. Plasmids 101: Knockout/Knock-In Plasmids

   Type

   Blog Post

   ... homology arms. The negative selection marker HSV-tk is used to select against random recombinants. ...selection marker like the HSV thymidine kinase (HSV-tk) is included just outside one of the homology arms...

4. A Practical Guide to Optimizing AAV DIO and FLEx Vector Expression

   Type

   Blog Post

   ..., in a recent study by the Wickersham lab (Lavin, TK. 2020) it was determined that the optimal titer to...664–678. https://doi.org/10.1089/hum.2019.277 Lavin TK, Jin L, Lea NE, Wickersham IR (2020) Monosynaptic...

5. Back to Bacteria: CRISPR gRNA Multiplexing Using tRNAs

   Type

   Blog Post

   ...Nissim L, Perli SD, Fridkin A, Perez-Pinera P, Lu TK. Mol Cell. 2014 May 22;54(4):698-710. doi: 10.1016...

6. Luciferase Plasmid Collection

   Type

   Collection

   ...for normalization. Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion of 5' promoter... luciferase expression under the control of a HSV TK promoter for normalization. Modified from psi-CHECK2...

7. INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons

   Type

   Blog Post

   ... A,  He C , Xu M, Zhou Z, Smock DC, Tang K, Owens TK, Krishnappa N, Sachdeva R, Deutschbauer AM, Banfield...

8. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

   Type

   Blog Post

   ...doi.org/10.1093/nar/gkt520 Citorik RJ, Mimee M, Lu TK (2014) Sequence-specific antimicrobials using efficiently...

9. Allen Institute for Brain Science AAV Enhancer Collection

   Type

   Collection

   ...GH, Morin E, Nguyen TN, Garren E, Bendrick JL, Kim TK, Zhou T, Mortrud M, Yao S, Siverts LA, Larsen R, ...

10. Sequencing Primers

    Type

    Guide

    ...end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA,...

11. Optogenetics Guide

    Type

    Guide

    ...SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, et al. 2014. Independent...