.../10.7554/elife.38853 Hu C-D, Chinenov Y, Kerppola TK (2002) Visualization of Interactions among bZIP and...://doi.org/10.1016/s1097-2765(02)00496-3 Kerppola TK (2006) Design and implementation of bimolecular fluorescence.... https://doi.org/10.1038/nprot.2006.201 Kerppola TK (2013) Bimolecular Fluorescence Complementation (...

...enrichment, whereas pAAV-TK-Acceptor has a conventional heterologous promoter-driven TK-neoR gene. To modify... AAV tagging vectors (pAAV-SEPT-Acceptor and pAAV-TK-Acceptor) so that they can be easily adapted to edit...

... homology arms. The negative selection marker HSV-tk is used to select against random recombinants. ...selection marker like the HSV thymidine kinase (HSV-tk) is included just outside one of the homology arms...

..., in a recent study by the Wickersham lab (Lavin, TK. 2020) it was determined that the optimal titer to...664–678. https://doi.org/10.1089/hum.2019.277 Lavin TK, Jin L, Lea NE, Wickersham IR (2020) Monosynaptic...

... for normalization Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion of 5' promoter... luciferase expression under the control of a HSV TK promoter for normalization Ting Ni 174050 pGWB-nLUC... luciferase expression under the control of a HSV TK promoter for normalization. Modified from psi-CHECK2...

...Nissim L, Perli SD, Fridkin A, Perez-Pinera P, Lu TK. Mol Cell. 2014 May 22;54(4):698-710. doi: 10.1016...

... A,  He C , Xu M, Zhou Z, Smock DC, Tang K, Owens TK, Krishnappa N, Sachdeva R, Deutschbauer AM, Banfield...

...doi.org/10.1093/nar/gkt520 Citorik RJ, Mimee M, Lu TK (2014) Sequence-specific antimicrobials using efficiently...

...GH, Morin E, Nguyen TN, Garren E, Bendrick JL, Kim TK, Zhou T, Mortrud M, Yao S, Siverts LA, Larsen R, ...

...end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA,...

...SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, et al. 2014. Independent...