We narrowed to 15 results for: vector pCAG-GFP
-
TypeBlog Post... took place and reconstituted the EGFP expression cassette. (b) pCAG-EGxxFP target plasmid and pX330-sgRNA...Mashiko et al. 2013). The pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the...cloned directionally into the BbsI site. (c) The pCAG-EGxxFP target plasmid was co-transfected with pX330...Once amplified, you can insert this region into a pCAG-EGXXFP plasmid using standard cloning techniques...of transfecting HEK293T cells with your modified pCAG-EGXXFP plasmid along with the individual gRNAs in...Remember the primers you designed to generate your pCAG-EGXXFP plasmid? They are the perfect primer sets...clone the PCR products into a pBluescript cloning vector and sequence the resulting plasmid. It can take...
-
New and Upcoming Viral Vectors - September 2019
TypeBlog Post...pENN.AAV.hSyn.Cre.WPRE.hGH (105553-AAV5) Dre vector AAV phSyn1(S)-DreO-bGHpA (50363-AAV5) Flp vectors pAAV-EF1a-mCherry-IRES-Flpo...pAAV-EF1a-Flpo (55637-AAV1) Viral vectors coming soon! These vectors should be packaged and available ... of our viral vectors blog posts Find tips for preparing AAVs Download our viral vectors 101 eBook Resources...collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available...pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE...new tools to our inventory of ready-to-use viral vectors. Here are some of the AAV we have released in the...Sensors). We are expanding the inventory of these vectors to more serotypes. We currently package four variants... -
New and Upcoming Viral Vectors - December 2019
TypeBlog Post...pAAV.hSynapsin.SF-iGluSnFR.A184S Viral vectors coming soon! These vectors should be packaged and available ... of our viral vectors blog posts Find tips for preparing AAVs Download our viral vectors 101 eBook Resources...collection! Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO mCherry...new tools to our inventory of ready-to-use viral vectors. Here are some of the AAV we have released in the...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Biosensor AAV...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid Serotype... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...dim GFPs The availability of the three dimensional structure of GFP, its brighter mutant S65T-GFP, and...and GFP shRNA. Mice carrying the R26DsRedR; CRUSH-GFP; and Nestin-Cre alleles showed efficient GFP knockdown... existing transposon and vector systems and creating an all-synthetic vector that included only the elements... into a destination vector in a predefined order. Finally, the destination vectors are used with Multisite... eight entry vectors can be used for each Multisite Gateway compatible destination vector for a maximum...step, compatible Level 0 vectors are directionally assembled into a Level 1 vector creating a single transcriptional...of interest into the pCoofy vectors, select the appropriate pair of vector and gene primers from Table... -
27 Hot Plasmids from 2016
TypeBlog Post...expression vectors with various promoters suitable for in vivo expression, and/or produce vectors to make...pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination...prototrophic strains. The vectors were based on the original EasyClone vectors (Jensen et al 2013) allow...donor vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They... interest and cloned into provided destination vectors using low-cost, one-pot golden gate cloning that... Jacks Lab constructed several GMAP-compatible vectors for a wide variety of biological applications. ... -
Retrovirus Plasmids
TypeCollection...MSCV-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid...35617 pCAG-Eco Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG ...Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; also expresses GFP. See pMKO.1 puro.... Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian...with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression...Biosafety Guide Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook γ-Retrovirus (gamma-retrovirus) is an...Plasmid for transgene expression; also expresses GFP. Also see pMIG-w , a variant that has WRE, a post-transcriptional... -
Penn Vector Core Partnership with Addgene
TypeCollection...Viral Vector Packaging Service Penn Vector Core Transfer Viral Vector Packaging Service: Penn Vector Core...AAV vectors to the academic research community. The Penn Vector Core produced viral-based vectors for ...Transfer The University of Pennsylvania Vector Core (Penn Vector Core) and Addgene previously partnered...Addgene's viral vectors See Addgene's Current AAV inventory , which includes all viral vectors transferred...a viral vector with the Penn catalog ID: Based on low demand, production of some viral vectors have been...See the list of discontinued viral vectors . The following vectors are now available for distribution ... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-1-PV2527 99039-AAV1 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Bacterial Vectors - Includes tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial...Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression SGFP2 495 512 ...Expression pRSETA-PAGFP - Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast...Expression pFA6a-link-yEPAGFP-CaUra3 - Yeast Expression mPA-GFP-N1 - Mammalian Expression mPA-GFP-C1 - Mammalian...then scientists have engineered numerous GFP-variants and non-GFP proteins that result in a diverse set ...Mammalian Expression PA-GFP 504 517 14 Monomer (A206K) pPAGFP-N1 - Mammalian Expression pPAGFP-C1 - Mammalian ... -
Sequencing Primers
TypeGuide...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC...BamHI, reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer... -
Lentivirus Plasmids
TypeCollection...Packaging part of the FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco N/A Envelope Ecotropic...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG N/A Envelope VSV-G-expressing envelope plasmid...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid... -
Control AAV Preps
TypeCollection...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive... Viral Vector Packaging Service AAV Controls Viral Vector Packaging Service: Control...Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 6, 8, 9, 11, rg*, PHPeB...*, PHP.eB, PHP.S Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell... 5, 8, 9, rg* Deisseroth 122100 pAAV-EF1α1.1-GFP EF1a GFP Constitutive 2 Boyden 128434 pAAV-Ef1a-fDIO-... AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8, 9, rg* Zeng 59331 pAAV-CAG-FLEX-EGFP CAG EGFP... -
Tetracycline Inducible Expression
TypeCollection...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...plasmid. A single vector approach may not have as much flexibility and control as a dual vector design, but ...popular empty backbones, expression vectors for transactivators, and vectors for other applications, or search...Lentiviral Tet-Off vector for repressible expression with blasticidin selection. *Note: this vector contains an...blasticidin Lentiviral Tet-On vector with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON-3G Mammalian expression...Supernova) AAV vector for dox-inducible expression of Cre recombinase. Takuji Iwasato 63704 pRetroX GFP T2A Cre... -
Retrograde AAV viral preps
TypeCollection... pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control Fishell... PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control... Viral Vector Packaging Service AAV Retrograde AAV Viral Vector Packaging Service: Retrograde...pAAV-Syn-ChR2(H134R)-GFP Syn Activator Optogenetics Boyden 59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Inhibitor Optogenetics Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG Inhibitor...Recombinases Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases...Service , Addgene is producing ready-to-use viral vector preparations in a retrograde serotype from the ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Cpf1 Kim pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA... Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector for your...Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These systems...single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one vector, and plasmids...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...expression vectors for insertion of custom gRNA target sequences. CRISPR... -
Neurodegeneration Plasmid Collection
TypeCollection... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...