Skip to main content
Addgene

We narrowed to 9 results for: yamanaka

Showing: 1 - 9 of 9 results
  1. Four Factors that Differentiate the Stem Cell Field

    Type
    Blog Post
    ...cell field have described the Yamanaka paper as "life changing". Dr. Yamanaka himself, during his keynote... chance. Here was an opportunity to see Shinya Yamanaka celebrate the tenth anniversary of his landmark... and cMyc (the so called OSKM factors). As the Yamanaka lab's primary Addgene contact for many years, ...community – a community largely created due to Yamanaka’s seminal work. It didn't take very long to realize...realize that the effect of Dr. Yamanaka's work has been profound, and this is a rare instance in which...thought leaders in the field--including Shinya Yamanaka, George Q. Daley, Christine Mummery, Lorenz Studer...stepped back to give a big picture perspective: Dr. Yamanaka talked about his clinical trial patients with ...
  2. Starter guide to induced pluripotent stem cells (iPSCs) part 1:  A renaissance in regenerative medicine

    Type
    Blog Post
    ...generated from mouse fibroblasts in 2006 in Shinya Yamanaka’s lab, where the reprogramming factors were delivered... was taken forward the next year when both the Yamanaka and Thomson labs showed the successful generation...These stellar works led to a Nobel Prize for Dr. Yamanaka in 2012. Find plasmids for generating iPSCs iPSCs...PubMed PMID: 17989069. 8. Takahashi, K. and S. Yamanaka, Induction of pluripotent stem cells from mouse...
  3. Plasmids for Stem Cell Research

    Type
    Collection
    ...research led to Kazutoshi Takahashi and Shinya Yamanaka’s breakthrough development of induced pluripotent...8081. Kay and Wu MMLV-derived Retrovirus Human Yamanaka factors for generating human iPS cells; retroviral...defined factors. Cell. 2007 Nov 30. 131(5):861-72. Yamanaka Plasmid Human Non-integrating transient expression...Peripheral Blood Cells. Stem Cells. 2012 Nov 29. Yamanaka Replicating EBNA1 episome Human Non-integrating... iPS cells. Nat Methods. 2011 May;8(5):409-12. Yamanaka Replicating EBNA1 episome Human Non-integrating... MMLV-derived Retrovirus Mouse Original set of Yamanaka factors for generating mouse iPS cells; retroviral...defined factors. Cell. 2006 Aug 25. 126(4):663-76. Yamanaka piggyBac Mouse Doxycycline-inducible piggyBac ...
  4. KLF Research Plasmids

    Type
    Collection
    ...Tim Townes Robert Weinberg Knut Woltjen Shinya Yamanaka Feng Zhang About The Krüppel-like factors (KLFs...
  5. Sequencing Primers

    Type
    Guide
    ...forward primer pMX-S1811 GACGGCATCGCAGCTTGGATACAC (Yamanaka lab) MMLV sequence, 5' of MCS in pMXs vector, ...
Showing: 1 - 9 of 9 results