We narrowed to 277 results for: ATC

...the universities, a bright future. IMP provides matched one-on-one international mentorship, with the aim...

...Addgene.org Learn more about Careers at Addgene Watch out career videos  ...

...Versatile Viral Tool for Gene Expression in Mammals A Match Made in Heaven: CRISPR/Cas9 and AAV Viral Vector...

...culture. As viral production can change from one batch to another. For experimental consistency it’s a ...

...to history. The straightforwardness of RNAi is unmatched—unlike CRISPR experiments that require exogenous...

...important to consider. While the basic landscape of mismatches that can nevertheless still lead to activity ...

...Since Cre does not cause recombination between mismatched recognition sites, its presence induces first...

... 60 -70 bp . Purchase gene-specific crRNAs and matched ssODNs from commercial suppliers of CRISPR reagents...

...serious when the introverts arrive." I couldn’t watch the denial of facts or attempts to dismiss and defund...

... reflection occurs due to the refractive index mismatch between the glass and the water-like buffer the...

...Your Fluorescent Protein for Multi-Color Imaging Catch Up on Your GFP Background Resources at Addgene....

...Studies Hybridoma Bank Learn more about nanobodies Watch our Antibodies 101 animation, What is an Antibody...

... are designed to work together — no mixing and matching!   Figure 2: Plasmid isolation workflows...

...information will populate a list of possible Entrez Gene matches to your insert. Select the appropriate gene if ...

...with Cpf1 Additional Resources on Addgene.org Catch Up on Your CRISPR Background with Our Guide Pages...

...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:...

...reporters Additional Resources on Addgene.org Catch up on your CRISPR background with our CRISPR Guide...