We narrowed to 276 results for: ATC
-
TypeBlog PostPublishedNov. 6, 2015, 3:30 p.m....the universities, a bright future. IMP provides matched one-on-one international mentorship, with the aim...
-
RNA Interference in Plant Biology: New Tools for an Old Favorite
TypeBlog PostPublishedOct. 27, 2020, 1:15 p.m....to history. The straightforwardness of RNAi is unmatched—unlike CRISPR experiments that require exogenous... -
FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution
TypeBlog PostPublishedOct. 17, 2019, 12:28 p.m....Since Cre does not cause recombination between mismatched recognition sites, its presence induces first... -
9 tips for a successful postdoctoral experience
TypeBlog PostPublishedOct. 9, 2018, 12:21 p.m....Addgene.org Learn more about Careers at Addgene Watch out career videos ... -
Important Considerations When Using AAVs
TypeBlog PostPublishedJune 13, 2017, 2:30 p.m....Versatile Viral Tool for Gene Expression in Mammals A Match Made in Heaven: CRISPR/Cas9 and AAV Viral Vector... -
Quick Guide to All Things Lentivirus
TypeBlog PostPublishedMarch 21, 2017, 2:30 p.m....culture. As viral production can change from one batch to another. For experimental consistency it’s a ... -
Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein
TypeBlog PostPublishedJune 28, 2018, 3:01 p.m.... 60 -70 bp . Purchase gene-specific crRNAs and matched ssODNs from commercial suppliers of CRISPR reagents... -
Which Fluorescence Microscopy Technique is Best for Me?
TypeBlog PostPublishedOct. 10, 2017, 1:57 p.m.... reflection occurs due to the refractive index mismatch between the glass and the water-like buffer the... -
Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins
TypeBlog PostPublishedApril 25, 2017, 2:30 p.m....Your Fluorescent Protein for Multi-Color Imaging Catch Up on Your GFP Background Resources at Addgene.... -
With an Eye Towards the Future, We Look Back at the March for Science
TypeBlog PostPublishedOct. 24, 2017, 1:54 p.m....serious when the introverts arrive." I couldn’t watch the denial of facts or attempts to dismiss and defund... -
Antibodies 101: Introduction to Antibodies
TypeBlog PostPublishedJan. 19, 2021, 2:15 p.m....Studies Hybridoma Bank Learn more about nanobodies Watch our Antibodies 101 animation, What is an Antibody... -
Selecting Your Plasmid Purification Kit
TypeBlog PostPublishedMay 27, 2025, 1:15 p.m.... are designed to work together — no mixing and matching! Figure 2: Plasmid isolation workflows... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog PostPublishedSept. 10, 2020, 11:45 a.m....with Cpf1 Additional Resources on Addgene.org Catch Up on Your CRISPR Background with Our Guide Pages... -
How to Deposit Your Plasmids with Addgene
TypeBlog PostPublishedFeb. 27, 2024, 2:15 p.m....information will populate a list of possible Entrez Gene matches to your insert. Select the appropriate gene if ... -
CRISPR/Cas9 FAQs Answered!
TypeBlog PostPublishedMarch 13, 2014, 4:08 p.m....can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:... -
CRISPR 101: Cytosine and Adenine Base Editors
TypeBlog PostPublishedFeb. 13, 2025, 2:15 p.m....reporters Additional Resources on Addgene.org Catch up on your CRISPR background with our CRISPR Guide...