We narrowed to 103 results for: primer

..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper (Cong et al., 2013...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...

...unresolved and small, so I suggest designing your primer at least 50bp upstream of the sequence of interest...

...protein databases, DNA sequence manipulation, and primer design. Best wishes for the new year and your ...

...protein), you can amplify the desired region using primers containing the homology arms on both sides and ...repair templates using Addgene plasmids. Design PCR primers to add T7 promoter-left homology arm and right ...

...electroporation, sort your transfected cells via FACS, primer validation, and screening by PCR for biallelic ...

...been integrated. Simply design your amplification primers with the desired targeting homology—in frame, of...

...Substrate dsDNA inserts can be made by PCR using primers that amplify the DNA sequence of interest and flank...the targeted insert site (Figure 2, top).  These primers are typically ~70 nucleotides long (20 nucleotides...

...the Addgene Blog Using Virus in Your Research: A Primer for Beginners Lentiviral Vector Uses and Overview...

...strategies set experiments back days or even weeks. Primer design was done painstakingly by hand. Records ...

...sequencing (NGS). For gRNA libraries, you’ll design primers to create 200-300 bp sequencing products using ...