Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 14 results for: primer

Showing: 1 - 14 of 14 results

  1. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...Table 4 ). Design Deletion Screening Primers Design one set of primers internal to the sequence to be deleted...promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC. This is a representative sequencing primer; other flanking...10 μl 2x PCR mix, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer (10 μM), 50-100 ng gDNA, and H 2...deleted (“non-deletion band”) and another set of primers upstream and downstream of the sgRNA cleavage sites...too large to efficiently amplify. Typically use primers at least 100 bp from the predicted cleavage site...indel at the sgRNA target site. Design additional primers to analyze for scarring (small indels produced ...intended deletion). Use a pair of forward and reverse primers flanking each sgRNA target site (within 150 - 350...

  2. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...sequences for each (these can be built into PCR primers when creating a new part, with an additional 5'...suffix will need to be reverse complimented for primer design. The restriction enzymes used for assembly...

  3. Viral Production

    Type
    Collection
    ...are titered by droplet digital PCR (ddPCR) using primers and probes targeting the ITR elements and an internal...incubated for 72 h, and genomic DNA is extracted. Primers and probes targeting integrated copies of the lentiviral...

  4. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ..., but couldn't amplify the EMX1 gene using same primer you used in the Science paper ( Cong et al. , Science...publication of our paper, we have two new optimized primers that may work better than the published ones, so...reaction still does NOT work, you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse...

  5. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...protothropic cassette can be amplified with the following primers: FW 5'–GGTGACGGTGCTGGTTTA–3' RV 5'–TCGATGAATTCGAGCTCG...

  6. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...

  7. Antibody Production

    Type
    Collection
    ...residual plasmid is extracted and amplified with primers targeting the heavy chain and/or light chain variable...

  8. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...the target site. The longer pegRNA also encodes a primer binding site (PBS) and the desired edits on an ...

  9. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...

  11. CRISPR Plasmids - Plants

    Type
    Collection
    ...by homology to a genomic DNA locus and encodes a primer binding site and the desired edits on an RT template...

  13. Plan Your Experiment

    Type
    Collection
    ... region of interest can be PCR amplified using primers that (A) flank the region of interest (deletions...

  14. CRISPR Guide

    Type
    Collection
    ...flap. However, the longer pegRNA also encodes a primer binding site (PBS) and the desired edits on a RT...gRNA; a specialized gRNA containing an additional primer binding site and reverse transcription template...
Showing: 1 - 14 of 14 results