We narrowed to 277 results for: ATC

...Resources at Addgene.org Find careers at Addgene Watch out career videos Sign up for the Addgene quarterly...

...Find tips on choosing an electronic lab notebook Watch a livestream of the Minisymposium on Reproducibility...

...resultant U-G pair is either repaired by cellular mismatch repair machinery making an original C-G pair converted...

...improved expression homogeneity, as the cells could be batch-sorted to isolate a polyclonal cell line with strong...

....org Find Cas9 Activators Find Cas9 Repressors Catch Up on Your CRISPR Background with Our CRISPR Guide...

...gRNA targets in that region. The CRISPR Software Matchmaker can be used to determine the pros and cons of...

... lines you are using, it is best to start from scratch. Obtain a vial of the desired cell line from a ...

...delivery of a double-stranded RNA (dsRNA) that matches the mRNA target sequence. The dsRNA can be delivered...

...beads through an assembly of biotinylated SpyTag-SpyCatcher linkers and spacer proteins ending with a GFP...

...allelic exchange Read our molecular biology reference Watch molecular biology protocol videos ...

...Where do they come from and what do they mean? A Match Made in Heaven: CRISPR and AAV Resources on Addgene.org...

... However, since some guide RNAs may tolerate a mismatch in the binding sequence, we recommend changing...

...cleavage at predicted off-target sites with up to 7 mismatches to the gRNA target sequence. Kaminski et al. ...

...development of many distinct CRISPR therapies to match these different mutations. For each therapy, effectiveness...

...Consequence dam DNA adenine methylase mutation (GATC) Preparing unmethylated DNA, important when trying...

...have created many engineered serotypes by mixing, matching, and modifying capsid and genomic structures. ...

...fluorescent secondaries on hand in the lab to mix and match with primaries for whichever targets you like. Plus...

...incorporating low metabolic burden seed-stock and fed-batch fermentation processes. Biotechnol Bioeng. 2009 ...

...tissues to demonstrate that the protein staining matches the expected expression patterns across tissues...

...Addgene.org Find Vectors with the piggyBac™ Transposon Catch up on Everything CRISPR with Our CRISPR Guide Deposit...

...the universities, a bright future. IMP provides matched one-on-one international mentorship, with the aim...

...to history. The straightforwardness of RNAi is unmatched—unlike CRISPR experiments that require exogenous...

...important to consider. While the basic landscape of mismatches that can nevertheless still lead to activity ...

...Versatile Viral Tool for Gene Expression in Mammals A Match Made in Heaven: CRISPR/Cas9 and AAV Viral Vector...

...culture. As viral production can change from one batch to another. For experimental consistency it’s a ...

...Since Cre does not cause recombination between mismatched recognition sites, its presence induces first...

...Addgene.org Learn more about Careers at Addgene Watch out career videos  ...

...Studies Hybridoma Bank Learn more about nanobodies Watch our Antibodies 101 animation, What is an Antibody...

...Your Fluorescent Protein for Multi-Color Imaging Catch Up on Your GFP Background Resources at Addgene....

... 60 -70 bp . Purchase gene-specific crRNAs and matched ssODNs from commercial suppliers of CRISPR reagents...

...serious when the introverts arrive." I couldn’t watch the denial of facts or attempts to dismiss and defund...

... reflection occurs due to the refractive index mismatch between the glass and the water-like buffer the...

... are designed to work together — no mixing and matching!   Figure 2: Plasmid isolation workflows...

...information will populate a list of possible Entrez Gene matches to your insert. Select the appropriate gene if ...

...with Cpf1 Additional Resources on Addgene.org Catch Up on Your CRISPR Background with Our Guide Pages...

...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:...

...reporters Additional Resources on Addgene.org Catch up on your CRISPR background with our CRISPR Guide...