Skip to main content
Addgene
Showing: 11 - 20 of 33 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...
  2. Plan Your Experiment

    Type
    Collection
    ... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...
  3. Brain Initiative Collection

    Type
    Collection
    ...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent...
  4. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ...pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes URA3 Davis eSpCas9(1.1) 71814...
  5. Genetic Code Expansion

    Type
    Collection
    ...Ryan Mehl 85496 pDule-Tet2.0 Tetrazine2.0 tRNA synthetase M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Ryan Mehl 85497 pDule2-Tet2.0 Tetrazine2.0 tRNA synthetas M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Bacterial TAG Ryan Mehl 164580 pUltraI-Tet3.0[TAA] Tet3.0RS M. barkeri Tet3.0 Bacterial TAA Ryan Mehl 172482 ...TAG Ryan Mehl 174080 pDule-Tet3.0 Tet3.0 tRNA synthetase M. barkeri Tetrazine 3.0 Bacterial TAG Ryan Mehl...NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84 tRNA synthetase M. barkeri Tetrazine 3.0 Mammalian Ryan...aminoacyl-tRNA synthetase M. jannaschii 1,2,4,5-tetrazine ncAAs Bacterial TAG Ryan Mehl 217361 pIDTSmart-MbPylRS...
  6. Bacterial Expression Systems

    Type
    Collection
    ... pdCas9-bacteria 44249 pTetO Anhydrotetracycline Stanley Qi Anhydrotetracycline inducible expression of... light. pCph8 50552 pLtetO-1 Anhydrotetracycline Jeffrey Tabor Anhydrotetracycline inducible expression... Plasmids pBAD, OR2-OR1-PR, pLtetO, pLlacO Arabinose, Anhydrotetracycline, lactose, IPTG Richard Murray...pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline inducible expression of wild-type Cas9 from...
  7. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...sensors, ER-targeted CEPIA1er ER-mitochondria tethering by PDZD8 regulates Ca(2+) dynamics in mammalian..., reagentless biosensor for ADP based on tetramethylrhodamine-labeled ParM A fluorescent, reagentless ...reagentless biosensor for ADP based on tetramethylrhodamine-labeled ParM. ACS Chem Biol. 2010 Apr 16;5(4):415-25...single cells. Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0...dual-color imaging. PLoS One. 2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based...in vivo imaging. Sci Rep. 2017 Aug 4;7(1):7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor ...and PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP (cyclic GMP) FlincG3 (GFP-based ...
  8. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...eqFP611 559 611 35 Tetramer eqFP611-N1 - Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian...CYPet-C1 - Mammalian Expression AmCyan1 453 486 11 Tetramer AmCyan1-N1 - Mammalian Expression MiCy (Midoriishi-Cyan...Expression (cysteine-free SGFP2) ZsGreen 493 505 39 Tetramer pHIV-Zsgreen - Mammalian Expression (this is a...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1 530...Expression Kaede 508 / 572 518 / 580 87 / 20 5.6/5.6 Tetramer Kaede-N1 - Mammalian Expression Kaede-C2 - Mammalian...
  9. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TTGAGGACCATGACGTGCagctggagactgaagaGAGCAAGAAAGTTGGGAA tet2(ENSDART00000113020) TAL3376 & TAL3377 TCAAGACCAGATACTATCcccaagcttcctttccCAGCTACCACCTACTGAA...TCAAGACCAGATACTATCcccaagcttcctttccCAGCTACCACCTACTGAA tet3(ENSDART00000137355) TAL3378 & TAL3379 TTGCTCCTTGGTTGCATCtctgtcttcattatcaCAAACATTTTCTTCATTA...TTGCTCCTTGGTTGCATCtctgtcttcattatcaCAAACATTTTCTTCATTA tetmethylcytosinedioxygenase 1 TAL3572 & TAL3573 TCAACTCGCGCATCCACAaagcgaaatgttaagaGGGTGAAGGCTTCCATGA...TCAACTCGCGCATCCACAaagcgaaatgttaagaGGGTGAAGGCTTCCATGA tetmethylcytosinedioxygenase 3 TAL3574 & TAL3575 TTATTAGGCACTTTTTTGtaaacgctgtattccaTGCACTTTCCTGTCCACA...TTATTAGGCACTTTTTTGtaaacgctgtattccaTGCACTTTCCTGTCCACA tetmethylcytosinedioxygenase 3 (previous si:ch211-220a11.1) TAL3576...
  10. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...-5aa linker-Cerulean-6aa linker-Venus ACAV Heterotetrameric construct consisting of Amber-5aa linker-Cerulean...linker-Cerulean-5aa linker-Amber-6aa linker-Venus ACVA Heterotetrameric construct consisting of Amber-5aa linker-Cerulean...linker-Cerulean-5aa linker-Venus-6aa linker-Amber VCAA Heterotetrameric construct consisting of Venus-5aa linker-Cerulean...linker-Cerulean-5aa linker-Amber-6aa linker-Amber VCVV Heterotetrameric construct consisting of Venus-5aa linker-Cerulean...
Showing: 11 - 20 of 33 results