Skip to main content
Addgene

We narrowed to 27 results for: INV-E

Showing: 21 - 27 of 27 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. ... Sato inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A....26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A...
  2. Zebrafish Plasmid Collection

    Type
    Collection
    ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...to genetics, high-throughput screening and non-invasive live imaging. A standard toolbox of genetic methods...
  3. Viral Production

    Type
    Collection
    ...propagated in the endA -mutated NEB Stable strain of E. coli . In addition, plasmids are typically prepared...correct integrated provirus using PCR. This assay involves transducing cells with serial dilutions of the...
  4. Zhang Lab CRISPR Page

    Type
    Collection
    ...screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl D, Ebert BL,...) is a microbial nuclease system involved in defense against invading phages and plasmids. CRISPR loci...increase targeting efficiency. These plasmids use the inverted terminal repeats (ITR) from AAV serotype 2. SaCas9...
  5. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Osmolarity SED1 osmolarity biosensor, for expression in E. coli , yeast, or plants Intrinsically disordered ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron/Citroff...cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate...
  6. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Anti-MBP [N128A/4R] Maltose binding protein (MBP) E. coli Mouse IgG2a 206532 Anti-Keyhole limpet hemocyanin...IgG2a 206546 Anti-Thioredoxin [N245/44R] Thioredoxin E. coli Mouse IgG2a 206547 Anti-DNAH7 [N250/21R] DNAH7...separate elements of the R-mAb expression plasmid involved in coexpression of light (green) and heavy (blue...
  7. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...several sources (Chan Zuckerberg Initiative, MedGen, ClinVar) and is meant to be representative but not exhaustive...
Showing: 21 - 27 of 27 results