Skip to main content
Addgene

We narrowed to 10 results for: INV-E

Showing: 1 - 10 of 10 results
  1. CRISPR Guide

    Type
    Guide
    ...36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang, H. H., & Sternberg, S. H... R., Hanna, R. E., Hegde, M., Donovan, K. F., Strand, C., Sullender, M. E., Vaimberg, E. W., Goodale, ...edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed by the.... PMID: 26735016 Lee, J. K., Jeong, E., Lee, J., Jung, M., Shin, E., Kim, Y., Lee, K., Jung, I., Kim, ..., K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-Guided Human...Siouve, E., Becavin, C., Depardieu, F., & Bikard, D. (2018). Genome-wide CRISPR-dCas9 screens in E. coli...e1007749. PMID: 30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S.,...
  2. Molecular Biology Reference

    Type
    Guide
    ...prior to use in an experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod ...Addgene blog posts relating to common E. coli lab strains and E. coli strains specialized for protein ...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Working with Plasmids Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics...genes. For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - 6000 basepairs...inserted. When a plasmid exists extrachromosomally in E. coli , it is replicated independently and segregated...are many different naturally occurring strains of E. coli , some of which are deadly to humans. The majority...
  3. Adenovirus Guide

    Type
    Guide
    ..., Pierson, T. C., & Weaver, E. A. (2020). Characterization of a Species E Adenovirus Vector as a Zika ... new window) Lee, C. S., Bishop, E. S., Zhang, R., Yu, X., Farina, E. M., Yan, S., Zhao, C., Zheng, Z....AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli cells containing pAdEasy. pAdEasy is a ~33 kb...a new window) Lee, D., Liu, J., Junn, H. J., Lee, E. J., Jeong, K. S., & Seol, D. W. (2019). No more helper...after exposure to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid...multiple heavily-spliced transcripts flanked by two inverted terminal repeats (ITRs). Adenoviral genes are ... cargo in first-generation rAdV vectors. E3 is involved in evading host immunity and is not essential ...
  4. Lentiviral Vector Guide

    Type
    Guide
    ....2012.229 PMID: 23311447 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S.,...doi.org/10.3390/v3020132 PMID: 22049307 Ghaleh, H. E. G., Bolandian, M., Dorostkar, R., Jafari, A., & Pour...Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and ...Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF/p75...., Heckl, D., Ebert, B. L., Root, D. E., Doench, J. G., & Zhang, F. (2013). Genome-Scale CRISPR-CAS9 knockout..., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. M., Chen, I. S., Hahn...transcriptionally active regions, regions recently involved in translocation events, and other “fragile” genomic...
  5. Sequencing Primers

    Type
    Guide
    ... pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli araBAD promoter, forward primer...primer pBAD Reverse GATTTAATCTGTATCAGG (Invitrogen) For vectors with E. coli araBAD promoter, reverse primer...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...
  6. Plan Your Experiment

    Type
    Guide
    ...Horlbeck, M. A., Adamson, B., Villalta, J. E., Chen, Y., Whitehead, E. H., Guimaraes, C., Panning, B., Ploegh...Raychowdhury, R., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016...10.1016/j.tibtech.2017.11.006 PMID: 25307932 Hanna, R. E., & Doench, J. G. (2020). Design and analysis of CRISPR–Cas...methods is RNA delivery of Cas and gRNA. This method involves using in vitro transcription reactions to generate...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...., Deverman, B. E., & Gradinaru, V. (2017). Engineered AAVs for efficient noninvasive gene delivery to...opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary recombinant...Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala, D., Huang, C. C., Gerfen, C. R., Schiller...reading frames, Rep and Cap, flanked by two 145 bp inverted terminal repeats (ITRs). The Rep region encodes...proteins (Rep78, Rep68, Rep52, and Rep40), which are involved in genome replication and viral packaging. The...barrier (BBB), and a systemic AAV capsid could avoid invasive methods such as intracranial injection. Systemic...this rate-limiting step, scAAVs contain a dimeric inverted repeat DNA molecule that spontaneously reanneals...
  8. Promoters

    Type
    Guide
    ...operon trp Repressible by tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac...operator preventing transcription. The trp operon involved in the production of tryptophan is an example ...
  9. Optogenetics Guide

    Type
    Guide
    ...Optogenetics Resource Center Boyden ES, Zhang F, Bamberg E, Nagel G, Deisseroth K. 2005. Millisecond-timescale...brain, rendering the experimental procedure less invasive. Different activation wavelengths also make it...Henninger MA, Kodandaramaiah SB, et al. 2014. Noninvasive optical inhibition with a red-shifted microbial...
  10. Chemogenetics Guide

    Type
    Guide
    ...PMID: 26399324 (Link opens in a new window) Vardy E, Robinson JE, Li C, Olsen RHJ, DiBerto JF, et al. ...downstream signaling. GPCRs have been shown to be involved in a wide variety of biological processes, including...
Showing: 1 - 10 of 10 results