...36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang, H. H., & Sternberg, S. H... R., Hanna, R. E., Hegde, M., Donovan, K. F., Strand, C., Sullender, M. E., Vaimberg, E. W., Goodale, ...edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed by the.... PMID: 26735016 Lee, J. K., Jeong, E., Lee, J., Jung, M., Shin, E., Kim, Y., Lee, K., Jung, I., Kim, ..., K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-Guided Human...Siouve, E., Becavin, C., Depardieu, F., & Bikard, D. (2018). Genome-wide CRISPR-dCas9 screens in E. coli...e1007749. PMID: 30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S.,...

...prior to use in an experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod ...Addgene blog posts relating to common E. coli lab strains and E. coli strains specialized for protein ...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Working with Plasmids Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics...genes. For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - 6000 basepairs...inserted. When a plasmid exists extrachromosomally in E. coli , it is replicated independently and segregated...are many different naturally occurring strains of E. coli , some of which are deadly to humans. The majority...

...transformed into AdEasier-1 cells , which are BJ5183 E. coli cells containing pAdEasy™. pAdEasy™ is a ∼33Kb...Useful for very large inserts AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid...renders the virus replication incompetent. E3 is involved in evading host immunity and is not essential ... replication incompetent E3 Non-essential gene involved in immune evasion, deleted to increase packaging...cell line Transfer Vocabulary Term Definition ITR Inverted terminal repeat; Contains elements that promote...

... pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli araBAD promoter, forward primer...primer pBAD Reverse GATTTAATCTGTATCAGG (Invitrogen) For vectors with E. coli araBAD promoter, reverse primer...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...

...operon trp Repressible by tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac...operator preventing transcription. The trp operon involved in the production of tryptophan is an example ...

...Optogenetics Resource Center Boyden ES, Zhang F, Bamberg E, Nagel G, Deisseroth K. 2005. Millisecond-timescale...brain, rendering the experimental procedure less invasive. Different activation wavelengths also make it...Henninger MA, Kodandaramaiah SB, et al. 2014. Noninvasive optical inhibition with a red-shifted microbial...

...PMID: 26399324 (Link opens in a new window) Vardy E, Robinson JE, Li C, Olsen RHJ, DiBerto JF, et al. ...downstream signaling. GPCRs have been shown to be involved in a wide variety of biological processes, including...