We narrowed to 89 results for: IRE;
-
TypeCollection...BioRender.com. Select Your Desired Genetic Manipulation Different genetic manipulations require different CRISPR...percentage of DNA breaks will be repaired by NHEJ instead of incorporating your desired edit through HDR. Base ...methods and often require screening a larger pool of cells to find one with your desired edit. Lastly, you...base edits Can be paired with restriction enzymes for further customization Usually paired with a sequencing...must be experimentally verified Cut Nick Homology Directed Repair (HDR) Generate specific genomic edits, ...or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency compared...Activate Design and Clone Your gRNA Achieving your desired edit comes down to location, location, location...
-
Plasmids for Stem Cell Research
TypeCollection...and study of stem cells, from iPSC generation to directed differentiation....the body and have the capacity to give rise to an entire organism. iPSC technology removes the possible ...below. Once iPSCs have been created they can be directly differentiated into specific somatic stem cells...Plasmids below. Alternatively, it is also possible to directly differentiate one differentiated somatic cell ...endogenously-tagged gene variants or browse Addgene’s entire collection of Stem Cell Research Plasmids . For...lentiviral plasmids A drug-inducible system for direct reprogramming of human somatic cells to pluripotency...Highly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic ... -
Antibody Guide
TypeCollection...antibodies? Will you be using a direct or indirect detection method? If indirect, do you already have secondary...signal amplification through the indirect detection method. In the direct detection method, the signaling...most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein of...antibody methods, it can be done using either an indirect or direct method. Since IF uses fluorophore color to...cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires single-antibody...complex. Due to their increased manufacturing requirements, monoclonal antibodies are typically more expensive... Polyclonal antibodies are typically collected directly from animals and contain antibodies targeting ... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...technique creates diverse populations of mutants for directed evolution. ID Plasmid Gene/Insert Promoter Selectable...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert... -
CRISPR Plasmids - Bacteria
TypeCollection...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions... -
Brain Armamentarium
TypeCollection...Alias: CN4361) Expression of jGCaMP8s in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4360) Expression of jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...: CN4035) Expression of CoChR-EGFP in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...Alias: CN3987) Expression of jRGECO1a in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...AAV for Cre recombinase expression in striatal indirect pathway D2-MSNs Jonathan Ting Viviana Gradinaru... AAV for Cre recombinase expression in striatal direct pathway D1-MSNs Jonathan Ting Viviana Gradinaru... -
Genetic Code Expansion
TypeCollection... 105829 pIRE4-Azi Azi-tRNA synthetase (EAziRS) p-Azido-phenylalanine (Azi) Mammalian TAG Irene Coin 105830...biologists have expanded the genetic code by redirecting specific codons to encode amino acids beyond ...E.coli and can be mutated and screened through directed evolution to charge the tRNA with a different ...-like click amino acids, tRNA M15 Mammalian TAG Irene Coin 113644 pRF0G-Tyr tyrosyl-tRNA synthetase M....182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA.... Expresses yeast TrpRS/tRNA pair instead. For directed evolution of the liberated EcTrpRS/tRNA pair to... -
CRISPR History and Development for Genome Engineering
TypeCollection...contains a special Protospacer Adjacent Motif (PAM) directly after where the crRNA would bind. (5) After the...double-strand break (DSB) induced by Cas9 could be repaired through non-homologous end joining (NHEJ) , an...homology arms was supplied, the break could be repaired according to this template, allowing for precise...tags, or loxP/FRT sites, among others. Homology-directed repair (HDR) allows us to create a variety of ...occurred at a truly astonishing pace, with work directed towards increasing on-target editing rates and...cuts only one strand of DNA and can be used with paired gRNAs to lower off-target cleavage frequency. Truncated...rely on NHEJ or HDR: Base editors : Base editors directly convert bases without creating a double-strand... -
CRISPR Plasmids - Drosophila
TypeCollection...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions... -
Validated gRNA Sequences
TypeCollection...25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C....25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974...pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT 60212 cut S. pyogenes 25161212 Fire sv40 promoter...CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut ...GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 Fire rgs4 D. rerio GGAGAAGGTGAAGGACACTG 42246 cut S. ...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut...GGAACTCGTGTCAAAACAAC 59932 cut S. pyogenes 25161212 Fire unc-119 C. elegans GAATTTTCTGAAATTAAAGA 46169 cut... -
Viral Vectors
TypeCollection...genome directs the production of more viruses. However, in theory, a viral genome could direct the host... of their mild immunogencity. These viruses can direct long-term transgene expression, but generally are...Adenoviruses have high transduction efficiency and direct high but transient transgene expression. γ-Retrovirus...molecules or to express other genes. Viruses used to direct these alternate functions simply have to harbor...array of viral genomes, enabling researchers to direct a wide array of genetic functions in cells. For... through the removal of certain genes that are required for viral replication. Thus, as a safety feature...occurring viruses do. Instead, the genes that are required for viral replication are usually divided among... -
CRISPR Plasmids - Plants
TypeCollection...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions... -
CRISPR Plasmids - Yeast
TypeCollection...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Description Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions... FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9 to a specific locus, avoiding known transcription...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids.... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Monitoring the action of redox-directed cancer therapeutics using a human peroxiredoxin-2-based probe. Nat Commun... with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with peroxiredoxin-based...cellular locations. PLoS One. 2012;7(11):e49371. Direct comparison of a genetically encoded sensor and ...11/520/eaah3738. Justin Blau cAMP (cyclic AMP) cAMPFIRE cAMP biosensors with improved sensitivity Sensitive... PLoS One. 2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron...mitochondrial or cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors...mammalian expression (Constitutive or Cre-dependent) Directed Evolution of a Selective and Sensitive Serotonin... -
Worm Expression Resources
TypeCollection...Wormbuilder website. General Tools Fire Lab C. elegans Vector Kit - Andrew Fire Lab. A set of vectors for C....characterized which allow researchers to express desired constructs in precise cell types and/or developmental...plasmids that can be used in worms, search Addgene's entire collection. ID Plasmid Description Gene/Insert ...modified approach has also been developed by the Fire laboratory and described in Efficient Marker-Free...vectors. C. elegans optimized fluorophores - Andrew Fire Lab. Available with and without PATC, which diminishes... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...off-target alterations and require only a single gRNA. Cas3 must be paired with the Cascade ( C RISPR-...can continue for many kilobases in one or both directions from the target region, effectively turning Cas3... Cas5, Cas6, Cas7, Cas8, and Cas11. Cascade is directed to target DNA using a gRNA and recruits Cas3. ...other proteins bound to DNA, and the break can be repaired by the cell’s endogenous repair mechanisms. Cas3... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Expression mT-sapphire 399 511 Monomer (A206K) mT-Sapphire-N1 - Mammalian Expression mT-Sapphire-C1 - Mammalian...Structure Plasmids T-sapphire 399 511 26 4.9 1.3 hr Prone to dimerization pFA6a-link-yETSapphire-CaUra3 - Yeast...Mammalian Expression mT-Sapphire-pBAD - Bacterial Expression mAmetrine 406 526 26 6 0.8 hr Monomer (A206K... -
Rett Syndrome
TypeCollection..., is regression of previously acquired skills, notably loss of acquired purposeful hand movements and ...Envigo. The following cell lines are available directly from the labs in which they were created. Find...rsrt.org The following cell lines are available directly from the labs in which they were created. Find... a p.R168X or p.T158M MECP2 mutation, and the direction and degree of skewing of X-chromosome inactivation... -
DNA Service - Cloning Grade DNA
TypeCollection...removing the amplification and extraction steps required when one receives plasmids in bacterial stabs....yield slightly different DNA concentrations. Can I directly transfect cloning grade DNA into cells? Cloning...DNA is designed for use in cloning applications. Direct transfection into cells is not recommended. Can...independently including the check out and will require separate shipping charges. Where can I find cloning... -
CRISPR Plasmids - C. elegans
TypeCollection...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids....