We narrowed to 34 results for: MYC;
-
TypeCollection... 8 Karl Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 CAG GFPsm_myc (does not fluoresce) Cre ...
-
Penn Vector Core Partnership with Addgene
TypeCollection...Loren Looger AV-1-PV3661 98927-AAV1 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 Control Loren Looger AV-10-PV0101...Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger AV-1-ALL856 100048-AAV1 pAAV.CAG.LSL.tdTomato... -
Fluorescent Protein Guide: In Vivo Imaging
TypeCollection....4 pcDNA3-mNeptune-N E2-Crimson 611/646 28.98 pEF.myc.ER-E2-Crimson Near-Infrared Protein Excitation/Emission... -
Malate Dehydrogenase CUREs Community Collection
TypeCollection...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...reporter vector expressing firefly luciferase with neomycin resistance. Christopher Vakoc 138152 pLentiEGFPdestablized... -
Retrovirus Plasmids
TypeCollection... For cloning and gene expression; select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE... -
CRISPR Plasmids - Drosophila
TypeCollection...Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu 45946 pU6-BbsI-chiRNA dU6... -
CRISPR Plasmids - Prime Edit
TypeCollection...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG... -
CRISPR Plasmids - Bacteria
TypeCollection...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9... -
CRISPR Plasmids - Plants
TypeCollection... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids... -
Ras Pathway
TypeCollection...protein, LST8 homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2 Nuclear factor, erythroid... -
CRISPR References and Information
TypeCollection...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2... -
CRISPR History and Development for Genome Engineering
TypeCollection...and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and... -
Validated gRNA Sequences
TypeCollection...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787...