We narrowed to 34 results for: Mycs;
- 
  TypeCollection...cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast, 21 (8):661-70. https://doi.org...antibiotic selection markers for engineering in Saccharomyces cerevisiae. Microb Cell Fact, 12 :96. https:...
- 
  Control AAV PrepsTypeCollection... 8 Karl Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 CAG GFPsm_myc (does not fluoresce) Cre ...
- 
  Penn Vector Core Partnership with AddgeneTypeCollection...Loren Looger AV-1-PV3661 98927-AAV1 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 Control Loren Looger AV-10-PV0101...Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger AV-1-ALL856 100048-AAV1 pAAV.CAG.LSL.tdTomato...
- 
  Fluorescent Protein Guide: In Vivo ImagingTypeCollection....4 pcDNA3-mNeptune-N E2-Crimson 611/646 28.98 pEF.myc.ER-E2-Crimson Near-Infrared Protein Excitation/Emission...
- 
  Malate Dehydrogenase CUREs Community CollectionTypeCollection...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic...
- 
  SARS-CoV-2 Pseudotyped VirusTypeCollection...reporter vector expressing firefly luciferase with neomycin resistance. Christopher Vakoc 138152 pLentiEGFPdestablized...
- 
  CRISPR Plasmids - DrosophilaTypeCollection...Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu 45946 pU6-BbsI-chiRNA dU6...
- 
  CRISPR Plasmids - Prime EditTypeCollection...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...
- 
  CRISPR Plasmids - BacteriaTypeCollection...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9...
- 
  CRISPR Plasmids - PlantsTypeCollection... As Cpf1 Qi 91715 pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids...
- 
  Ras PathwayTypeCollection...protein, LST8 homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2 Nuclear factor, erythroid...
- 
  CRISPR References and InformationTypeCollection...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2...
- 
  CRISPR History and Development for Genome EngineeringTypeCollection...and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and...
- 
  Validated gRNA SequencesTypeCollection...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787...