We narrowed to 32 results for: cki
-
TypeCollection... Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad Institute...
-
Optogenetics AAV Preps
TypeCollection...tdTomato Cre dependent 1, 5, 8 Boyden 105669 pAAV-CKIIa-stGtACR2-FusionRed CaMKII GtACR2 (soma-targeted)... -
Retrograde AAV viral preps
TypeCollection...CamKII Inhibitor Optogenetics Boyden 105669 pAAV-CKIIa-stGtACR2-FusionRed CamKII Inhibitor Optogenetics... -
The Pleiades Promoter Project
TypeCollection...Castellarin M, Chen J, Chen Y, Cheng JC, Chopra V, Docking TR, Dreolini L, D'Souza CA, Flynn EK, Glenn R, ... -
CRISPR History and Development for Genome Engineering
TypeCollection...Newberry KM, Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. 2015. CETCh-seq: ... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...at 400 x g for 5 min and remove supernatant by flicking the PCR plate over a sink. Add 50 μl of DNA extraction... -
Bacterial Expression Systems
TypeCollection... Engineering Modifying the bacterial genome by knocking out genes or introducing specific mutations can... -
Plasmids for Stem Cell Research
TypeCollection...non-integrating episomes to allow sorting and dosage tracking of reprogramming factors Fluorescent tagged episomals... -
Tetracycline Inducible Expression
TypeCollection...normal conditions, the TetR protein binds to tet O, blocking transcription of the downstream gene. If tet or... -
Validated gRNA Sequences
TypeCollection...interfere S. pyogenes 26689101 Hudson xylR C. beijerinckii CGAGTTAGACATAATAGTGA 73228 nick S. pyogenes ... -
Antibody Guide
TypeCollection...unused surface-binding sites in the wells with a blocking protein such as BSA, followed by several wash ... -
Immunology Research Plasmids and Resources
TypeCollection...SCYA20, ST38 CCL21 chemokine (C-C motif) ligand 21 6Ckine, CKb9, ECL, MGC34555, SCYA21, SLC, TCA4 CCL22 chemokine...