Skip to main content

We narrowed to 108 results for: lat

Showing: 21 - 40 of 108 results
  1. Deisseroth INTRSECT Collection

    Type
    Collection
    ...viral expression of molecular payloads in target populations defined by multiple parameters....expressing these tools in well-defined cellular sub-populations has generally been limited to single-component...viral expression of molecular payloads in target populations defined by multiple parameters. Figure 1: Examples...Examples of intersectional cell population definitions using recombinases. A) Cre and Flp are multiplexed... to enable intersectional viral targeting of populations expressing only Cre AND Flp, Cre NOT Flp, or ...recombinase-expression strategies to define cellular sub-populations of interest, including dual-transgenic recombinase-expressing... NOT Cre No Dual recombinase-dependent: Rabies-related Addgene ID Plasmid Logic Sites and Mutations In-Stock...
  2. Viral Production

    Type
    Collection
    ...cells several days later, and isolating genomic DNA. This DNA is then used as a template to amplify a portion...Next-generation sequencing is performed on viral genomes isolated from the final AAV preparation. Sequencing results...of AAV preparations is assayed by comparing the relative stoichiometric ratios of the viral capsid proteins...SYPRO Ruby staining and the molecular weight and relative intensity of the viral capsid proteins are analyzed...Viral capsid proteins VP1, VP2, and VP3 are shown relative to the total protein present in the sample. Sterility...are added to cells in culture. Three to five days later, cell cultures are inspected for sterility. Transducibility...-AAVrg) alone at 1.1E6 vg/mL, or both. Two days later, Cre-dependent GFP expression was detected with ...
  3. Neurodegeneration Research Collection

    Type
    Collection
    ...available at Addgene. Amyotrophic Lateral Sclerosis Amyotrophic lateral sclerosis (ALS), sometimes referred...individuals develop late-onset AD. There is no clear association between a gene and late-onset AD. It is ... between a person’s thirties and mid-sixties, or late-onset, where symptoms appear during or after a person's...APOE), such as the ε4 allele, are a risk factor for late-onset AD. Many more genes have been associated with...reporter to study tau seeding in mammalian cells. Lathuiliere et al. Mol Neurodegener. 2023 Aug 8. Study the...growing collection of general and neuroscience -related antibodies including: Anti-KChIP1 K+ channel [K55...high-volume hybridoma sequencing on the NeuroMabSeq platform. Mitchell et al. Sci Rep. 2023 Sep 27. See More...
  4. Tetracycline Inducible Expression

    Type
    Collection
    ...Learn about tetracycline-regulated gene expression and find plasmids for your experiments using tet- ...view highlighted Tet plasmids . Figure 1: Tet-regulated expression systems. Left: natural TetR mechanism...transduced cells express both components in the same relative ratio. Different generations of transactivators...of background expression. For example, only a relatively low level of doxycycline can access the brain...toxicity, a known half-life (24 hours), and is relatively inexpensive. The induction profiles for dox and...applications, or search our collection for all dox-regulated plasmids . Looking for viral preps? Find in-stock... systems or search our collection for all dox-regulated plasmids . ID Plasmid Description PI 63800 PB-...
  5. Synthetic Biology - Overview

    Type
    Collection
    ...plasmids related to metabolic pathways and auxiliary components. Networks and Gene Regulation Browse plasmids...Lab Biopixels Jaramillo Lab Riboregulation Keasling Lab BglBrick Platform , Terpenoid Production , and...Category Cloning and Genomic Tools Browse plasmids related to cloning and genomic modification, including ...containing both naturally occurring and synthetic regulatory elements, including promoters, terminators, repressors...networks. Sensing and Signaling Browse plasmids related to intercellular signaling and environmental sensing...Plasmids and Phagemids Balazsi Lab Negative Autoregulation and Yeast-Mammalian Circuit Transfer C. Collins...
  6. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...powerful genome engineering tools used to precisely manipulate DNA and control the expression of specific genes...Dre with rox sites), enabling precise genetic manipulation without cross-reactivity with other recombinase... in the presence of tamoxifen. A tetracycline-regulated or other drug-inducible approach may also be used...Genes A and B. When Cre is absent, only Gene A is translated correctly. Cre expression excises Gene A and ...and alters the reading frame to allow in-frame translation of Gene B. FLEx Switch (for “flip-excision”):...available, both mutant and wild type. The ability to manipulate the number, orientation, and type of target sites...can improve specificity in targeted neuronal populations. Read our blog post about how to minimize leakiness...
  7. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid...the spread of infection throughout the entire population. ID Plasmid Promoter PI Publication Purify A ...
  8. Zhang Lab CRISPR Page

    Type
    Collection
    ...and constitutively expressing Cas9 knockin mice (Platt et al ., Cell 2014). In these mice the CRISPR-Cas9...luciferase-2A-Cre recombinase, and Kras G12D HDR template 60225 : control for AAV-KPL; sgRNA targeted to...expression vectors for cancer modeling Using Cas9 mice, Platt et al . simultaneously modeled the dynamics of KRAS...contains a Kras G12D homology directed repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-...to enable the rapid ligation of annealed and phosphorylated oligos designed based on the target site sequence...for genome editing in the brain Using Cas9 mice Platt et al. demonstrated in vivo genome editing in the...
  9. COVID-19 Resources

    Type
    Collection
    ...COVID-19 and related coronaviruses. Addgene assisted this effort by providing a platform for the distribution...tools that are useful for COVID-19 related research. Additionally, we have linked to collections...articles, protocols, and other resource collections related to COVID-19 that may be of use to scientists. Antibodies...Description Industry PI Due to export control regulations, MERS and SARS-CoV materials are available only...entry of SARS-CoV and SARS-CoV-2. Find plasmids related to these genes below. ID Plasmid Description Industry... in the body. For a full list of cytokines and related plasmids see our Immunology Resource Guide . Return... Many publishers allow free access to articles related to SARS-CoV-2 research: Cell Press Coronavirus ...
  10. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ...sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting spacer...the Bikard Lab, CRISPR plasmid collection for modulating expression levels of two targets independently...has deposited a collection of CRISPR arrays to modulate the expression levels of two targets independently...sb400021j Figure 1: Multiplexing CRISPR knockdown to modulate expression of two genes without cross‐talk. (A... a single cell, and each color represents the population obtained with one CRISPR plasmid. An overlaid... connects the median values of the different populations. Image and caption from Vigouroux et al., 2018...
  11. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...They are frequently used in molecular biology to isolate, multiply, or express the insert they carry in ...Viral Vector Delivery, Genome Modification, mRNA Regulation, and More Selectable Markers Species-Specific...This means that the final product should be translated as a single string of amino acids that preserves...3Myc-EYFP-HA-His6 and IRES-dependent ECFP-HA-His6 translation for mammalian expression pDest-527 - N-terminal... pDest vector that adds an N-terminal myristoylation signal GST Protein purification...information Genome Modifications, Reporter Assays, mRNA Regulation, and More Find empty backbones for other uses...plasmid backbones into which you can clone your regulatory element or gene of interest to create a luciferase...
  12. CRISPR Plasmids - Plants

    Type
    Collection
    ...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid...none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295 pRGEB31 rice snoRNA...
  13. Plasmids for Stem Cell Research

    Type
    Collection
    ...multiple cell types, but are typically limited to related cell lineages. Pluripotent embryonic and multipotent...technology removes the possible ethical concerns related to embryonic stem cell use and has the major advantage...to generate iPSCs. The generation of iPSCs is relatively simple in concept: ectopically express a cocktail...BRD3R promotes human nuclear reprogramming and regulates mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa...polycistronic cassettes KLF4 N-terminal variance modulates induced reprogramming to pluripotency. Stem Cell...from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proc Natl Acad Sci... conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Stem Cell Reports...
  14. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ... for genetic screening experiments, due to the relative ease of designing gRNAs and the ability to modify...are treated with the pooled library to create a population of mutant cells that are then screened for a ...3rd 10 187,535 Advanced Catalogue of Epigenetic Regulators (ACER) 226117 Knockout Human Lu 3rd 10 8,205 ...3rd 4 2,852 Bonifacino Lab Human ubiquitination-related proteins CRISPR KO library 174592 Knockout Human...Knockout Mouse Tolar 3rd ~4 78,637 Mouse Chromatin Regulator Library 200011 Knockout Mouse Griffin, Manguso...Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout ...
  15. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid...
  16. Luciferase Plasmid Collection

    Type
    Collection
    ...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...backbone plasmids into which you can clone your regulatory element or gene of interest into to create a ...Reporter Constructs Already know what gene or regulatory element that you need a luciferase reporter for...search box to find a construct that contains your regulatory element of interest. ID Plasmid Description Gene... to study processes beyond transcription and translation. Splicing reporters from Younis et al., 2010 ...Optimized STARR-seq (Self-Transcribing Active Regulatory Region) : Genome-wide screening of enhancers ...
  17. Caltech Systemic Capsids

    Type
    Collection
    ...dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element...eYFP E2 regulatory element Activator C1V1 Dimidschstein 135634 pAAV-S5E2-ChR2-mCherry E2 regulatory element...Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory element; NHP, non-human primate. Image courtesy...DREADD Roth 135635 pAAV-S5E2-Gq-P2A-dTomato E2 regulatory element Activator DREADD Dimidschstein Biosensors...GCaMP Kim , GENIE 135632 pAAV-S5E2-GCaMP6f E2 regulatory element Calcium sensor GCaMP Dimidschstein 100854...
  18. TALEN Guide

    Type
    Collection
    ...Overview of TALEN Technology Imagine being able to manipulate a specific region of DNA in the genome of your...species almost as easily as correcting a typo in the latest draft of your dissertation. Well, that will probably...recognition code of the TAL effectors, which were isolated from the plant bacterial pathogen Xanthomonas....bind adenenine with lower specificity). With the template for studying this type of technology already laid...Intuitively, one would expect that assembling relatively small, repeat-laden DNA regions into a single...construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat Biotechnol. 2011...
  19. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...Find CRISPR plasmids to study the regulatory networks involved in retinal development....Collection The Brzezinski lab investigates gene regulation in the context of the developing mouse retina...retina. To aide in their studies of the regulatory networks involved in retinal development the lab utilizes...plasmid to expand its usefulness for the lab's gene regulation and developmental studies. Key plasmid features...followed by a quick ligation of annealed and phosphorylated oligonucleotides containing the guide target...
  20. Validated gRNA Sequences

    Type
    Collection
    ...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2:TCAACCGTCCCTGCAAGGCT...TCAACCGTCCCTGCAAGGCT 72623 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAAACCTCGTGTAGCTATCA; gRNA2: ...
Showing: 21 - 40 of 108 results