Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 52 results for: aav

Showing: 41 - 52 of 52 results

  1. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ... RNA-H1-nick sgRNA-mCherry Mammalian, AAV hU6 + H1 pegRNA + nicking sgRNA No mCherry Hyongbum...

  2. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... smaller than SpCas9 and more easily packaged in AAV. Cas9 orthologs also have distinct PAM sites that...also makes it suitable for multiplexing and use in AAV. Scientists have also developed CRISPR editing technologies...

  3. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Localization Optogenetics Plasmids Viral Service: AAV Biosensors Fluorescent biosensors are proteins designed...associated with the article. We also offer ready-to-use AAV preparations of select plasmids; these are noted ...Commun. 2018 Oct 25;9(1):4440. Eric Schreiter Calcium AAV expression of photoconvertible fluorescent protein-based...2024.12.16.628673. Olivia Masseck Calcium Astrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent...voltage imaging. Science. 2019 Aug 1. pii: science.aav6416. Eric Schreiter Voltage Green fluorescent voltage...

  4. Deisseroth INTRSECT Collection

    Type
    Collection
    ...targeting strategy that allows adeno-associated virus (AAV)-borne payloads to be expressed in cells based on... Items 55636 pAAV-EF1a-Cre None Yes 55632 pAAV-Ef1a-mCherry-IRES-Cre None Yes 55637 pAAV-EF1a-Flpo None...None Yes 55634 pAAV-EF1a-mCherry-IRES-Flpo None Yes 55638 pAAV-EF1a-vCre None Yes 55635 pAAV-EF1a-sCre None...Items 55641 pAAV-Ef1a-fDIO EYFP Flp Yes 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre No 55639 pAAV-Ef1a-fDIO...55650 pAAV-hSyn Con/Fon EYFP Cre AND Flp Yes 231926 pAAV-Ef1a-Con/Fon-EYFP Cre AND Flp No 55651 pAAV-hSyn...137134 pAAV-Ef1a-Coff/Fon-mCherry Flp AND NOT Cre Yes 137135 pAAV-Ef1a-oScarlet None Yes 137136 pAAV-Ef1a-Con... 137125 pAAV-Ef1a-sRGECO None Yes 137126 pAAV-Ef1a-Con/Fon-sRGECO Cre AND Flp Yes 137127 pAAV-Ef1a-Con...

  5. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286 Mouse Validation (mVAL) CRISPR Library 159391...

  6. Plasmids for Stem Cell Research

    Type
    Collection
    ...Jun 6. Buganim Glial Cells Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-...

  7. CRISPR Guide

    Type
    Collection
    ...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a retroviral...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in...

  8. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...-FP Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 ...74170 pVEX-CC1 DCTN1 tac ALS Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637 ...Parkinson's Hilal Lashuel 36055 pAAV asyn WT SNCA CMV Parkinson's Hilal Lashuel 36056 pAAV asyn S87A SNCA CMV Parkinson's...Hilal Lashuel 36066 pAAV asyn S129A SNCA CMV Parkinson's Patrick Aebischer 36067 pAAV asyn S129G SNCA CMV...Hilal Lashuel 36068 pAAV asyn S129E SNCA CMV Parkinson's Hilal Lashuel 36069 pAAV asyn S129D SNCA CMV ...Aebischer 36070 pAAV asyn S87A/S129A SNCA CMV Parkinson's Patrick Aebischer 36071 pAAV asyn S87D/S129A...Lashuel 107543 pAAV-AICD-NLS-IRES-hrGFP APP CMV Alzheimer's Hélène Marie 107544 pAAV-AICD-NES-IRES-hrGFP...

  9. Validated gRNA Sequences

    Type
    Collection
    ...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes...

  10. CRISPR Plasmids - Tagging

    Type
    Collection
    ...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...Addgene 41815 or #44719 ) in combination with gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector...vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Addgene #79888) , which expresses an untagged...safe harbor" locus: eSpCas9(1.1)_No_FLAG_AAVS1_T2 Doyon Lab TAP Tagging Protocol 97.2 KB Yamamoto PITCh Tagging...

  11. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-...mEGFP Ras-related protein Rab-5A Endosomes 107580 AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of ...AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ...
Showing: 41 - 52 of 52 results