Skip to main content
Addgene

We narrowed to 99 results for: lars

Showing: 41 - 60 of 99 results
  1. Microbiology Resources

    Type
    Collection
    ...MoClo Parts Kit : Molecular cloning for E. coli - Densmore Lab EcoFlex MoClo : Modular cloning for applications...Find plasmids to perform your experiment in a particular bacterial expression system. Fluorescent Protein...
  2. Worm Expression Resources

    Type
    Collection
    ...to adult) and easy lab maintenance. Worms are particularly well suited for studies in cell biology, development...fluorescent proteins, and Cre expression plasmids. Large collections or kits are described below and not ...C. elegans strains. CRISPR plasmids from John Calarco's lab as described in Heritable genome editing in...
  3. TALEN Guide

    Type
    Collection
    ...target sites. (B) A TAL effector nuclease (TALEN). Similar in principle to the ZF nuclease, the components...sequence ( Figure 1A ). Scientists have identified a large number of zinc fingers that recognize various nucleotide...array is an effective targeting mechanism for molecular tools. ZFs are not without their limitations, ...
  4. Validated gRNA Sequences

    Type
    Collection
    ...gRNA sequence in your particular experiment, so make sure to check out the particular conditions of the experiment...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut...
  5. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... can search or sort this table based on: Your particular expression system , eg. Mammalian, Lentiviral...sgRNA 46170 Worm PCR (see paper) none S. pyogenes Calarco SP6-sgRNA-scaffold 47912 Worm AflII none S. pyogenes...S. pyogenes BFP Kuhn pLKO.1-puro U6 sgRNA BfuAI large stuffer 52628 Mammalian/Lentiviral BfuAI none S....transcript Bullock pCRISPathBrick Bacteria Allows rapid modular assembly of natural type II-A CRISPR arrays capable...
  6. Lentivirus Plasmids

    Type
    Collection
    ...use Glossary of commonly used lentiviral terms Popular Lentiviral Envelope and Packaging Plasmids One ...packaging construct encoding Tat. Reiser Return to Top Popular Lentiviral Transfer Plasmids The lentiviral genome...tracking of viral transduction. See article for more similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha...
  7. CRISPR Plasmids - Tagging

    Type
    Collection
    ... fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin (FBL). To repeat the knock-in in your...Jorgensen Lab SapTrap CRISPR/Cas Toolkit SapTrap is a modular toolkit from Erik Jorgensen's lab for building ...
  8. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...introduce cleavage of the target site with efficiency similar to using a single chimeric gRNA. At the same time...cells with the Cas9/sgRNAs vector (like PX330). For large changes (>100bp insertions or deletions), we typically...lab typically use PAGE purified long oligos. For large changes (>100bp insertions or deletions), the Zhang...
  9. Retrograde AAV viral preps

    Type
    Collection
    ...Bidirectional DREADDs Activators Inhibitors Other Molecular Tools Clear Filters ID Name Promoter Activity ...with simultaneous dTomato expression Recombinases Larsen 107788 AAV.rTH.PI.Cre.SV40 rTH Cre expression Recombinases...pAAV-FLEX-EGFPL10a EF1a EGFPL10a, Cre-dependent Molecular Tool Heintz , Nectow , Schmidt No available items...
  10. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...selectable marker. They are frequently used in molecular biology to isolate, multiply, or express the insert... as GFP, which allows you to visualize the cellular localization of your protein. Additionally..., secretion, and display of proteins on the extracellular surface of S. cerevisiae cells His-tagged versions...
  11. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Biosensors Optogenetics Background...scaffold, scientists can design de novo systems using modular components or take advantage of existing GFP-lines...
  12. Zinc Finger Consortium Reagents

    Type
    Collection
    ...OPEN method Modular Assembly Engineering Reagents - Engineer zinc finger arrays via Modular Assembly method...
  13. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael ... of interest. Please visit Michael Davidson's Molecular Expressions website for additional images, tutorials...
  14. Brain Initiative Collection

    Type
    Collection
    ...BRAIN Initiative supports the development of biomolecular tools for neuroscience research. Browse the ...development and application of innovative tools enabling large-scale real-time interrogation and monitoring of ...supports the development of a diverse portfolio of biomolecular tools and emphasizes their rapid and broad dissemination...
  15. MAPK Plasmids

    Type
    Collection
    ...Mitogen-activated protein kinases (MAPKs), also known as extracellular signal-regulated kinases (ERKs), are serine/...threonine-specific protein kinases. They regulate diverse cellular programs by acting as an integration point for...
  16. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ...CRISPR-associated transposases (CASTs) combine the large-scale capacity of transposases (Tns) with the precise...CRISPR-Cas systems, allowing for the integration of large fragments of DNA at specific locations. The Cas ...
  17. DNA Service - Cloning Grade DNA

    Type
    Collection
    ...ordering cloning grade DNA for over 200 of our most popular plasmids!... available in this format include a variety of popular plasmids and backbones with high cloning potential...
  18. All Antibodies

    Type
    Collection
    ...produce antibodies are available as part of Addgene’s larger Antibody Plasmid Collection , which also includes... Tags and Other Markers : Antibodies targeting popular markers like tubulin or epitope tags like Myc, ...
  19. Institute for Protein Innovation

    Type
    Collection
    ...epitope tags to help purify, detect, or localize particular proteins. Browse or search the table below to...antibodies that target epitope tags and other common cellular proteins. ID Recombinant Antibody Description ...
Showing: 41 - 60 of 99 results