We narrowed to 80 results for: POR
-
TypeCollection...Serotype Testing AAV These AAV encode fluorescent reporters and can be used to compare the tropism of different...
-
Synthetic Biology - Overview
TypeCollection... modification, including shuttle, integration, reporter, and tagging vectors. Metabolism Browse plasmids... -
Adenovirus Plasmids
TypeCollection...plasmid, are recombined into a DNA molecule that incorporates sequences from both plasmids. This DNA molecule... -
Retrovirus Plasmids
TypeCollection...post-transcriptional regulatory element that increases export to the cytoplasm Hahn 11375 MDH1-PGK-GFP_2.0 MSCV... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...ACP-tag/MCP-tag product line from their product portfolio, including the CoA-derivative substrates and the... -
Chemogenetics AAV Preps
TypeCollection...PHPeB Clear Filters ID Name Receptor and Activity Reporter/Tag Cre requirement Serotype PI 44361 pAAV-hSyn-DIO-hM3D... -
CRISPR Plasmids - Prime Edit
TypeCollection...the PBS of the pegRNA and the desired edit is incorporated into the DNA by reverse transcription. The edited... -
Distribution to Industry
TypeCollection...processed and shipped. Industry Distribution Policy A portion of Addgene's collection is available to qualified... -
Microbiology Resources
TypeCollection...its library and distributions in accordance with export laws and biosafety regulations. Looking for E. ... -
AAV Packaged on Request
TypeCollection... on Request preps is all-inclusive of several important steps: MTA facilitation for the transfer plasmid... -
Plant Plasmids and Resources
TypeCollection...promoter’ in the tables for species-specific tools). Support open science in plant biology - deposit plant plasmids... -
p53 Pathway
TypeCollection... of p53’s pro-apoptotic effects is especially important to tumorigenesis. Inheriting only one functional... -
Lentiviral Prep Service
TypeCollection...on each item's material page. Actual titers are reported with each shipment. For more details about our... -
Brain Armamentarium
TypeCollection...function. Browse plasmids or viral preps created with support from the BRAIN Armamentarium Project below. Plasmids... -
CRISPR Plasmids - Tagging
TypeCollection...with the following article: Natsume, et al. Cell Reports 2016 Förstemann Drosophila Cell Tagging System ... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TALENs for Endogenous Zebrafish Gene Targets Recent reports have shown that engineered TALENs can be used to... -
Caltech Systemic Capsids
TypeCollection...tropism exhibited by the PHP.eB serotype has been reported to occur by using the cellular receptor LY6A (... -
CRISPR History and Development for Genome Engineering
TypeCollection...libraries can be used to identify genes that are important to a given phenotype. Current libraries are available... -
Zhang Lab CRISPR Page
TypeCollection...nucleolytically inactive Cas9-VP64 fusion A sgRNA incorporating two MS2 RNA aptamers at the tetraloop and stemloop... -
Validated gRNA Sequences
TypeCollection...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...