Skip to main content
Addgene

We narrowed to 121 results for: ell

Showing: 61 - 80 of 121 results
  1. Antibody Production

    Type
    Collection
    ...mammalian expression vectors, human embryonic kidney cells are transfected with the plasmid(s) encoding the.... This buffer is not compatible for use in live cells and will interfere with conjugation. For applications...antigen is first transiently expressed in mammalian cells. To learn which specific QC experiments were performed...email [email protected] . Immunocytochemistry (ICC) Cells are fixed and labeled with the antibody and a species-specific...Western Blotting (WB) Proteins are extracted from cells, separated by SDS-PAGE, transferred to a membrane...
  2. Chemogenetics AAV Preps

    Type
    Collection
    ...-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell...-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Fishell 50472 pAAV-GFAP-HA-rM3D... chemically induce neuronal activity in specific cell types. See our Chemogenetics Plasmids and Chemogenetics...
  3. Microbiology Resources

    Type
    Collection
    ... Ralstonia solanacearum Rickettsia sp. Salmonella sp. Shigella sp. Staphylococcus sp. Streptococcus sp...Species Anabaena sp. Bacillus sp. Burkholderia sp. Bordetella pertussis Campylobacter sp. Chlamydia sp. Clostridium...reading frames for vaccinia virus - Bennink and Yewdell Labs Yarrowia lipolytica Golden Gate tool kit :...applications like recombinant protein purification and cell-free circuit design in E. coli - Freemont Lab MoClo-YTK...
  4. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...to activate programmed cell death or dormancy for phage-infected bacterial cells so as to limit the spread...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...
  5. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...abundant forms of posttranslational modification in cells and research into its many roles in protein function...interactions can be discovered by fluorescence-activated cell sorting (FACS). The Mode #2 phosphosite library ... Barber, K. W., Ter Haar, C. M., Rogulina, S., Amrofell, M. B., Isaacs, F. J., Rinehart, J., & Jewett,... production of recombinant phosphoproteins using cell-free protein synthesis . Nature Communications ,...TBK1 activation to promote mitophagy . Molecular Cell , 60 (1), 7–20. https://doi.org/10.1016/j.molcel...
  6. Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection

    Type
    Collection
    ...be used for screening transcription factors for cellular programming or cancer drug resistance....Zhang Lab Plasmids The Human TFome Library Stem Cells Protocols & References MORF Plasmids MORF Pooled...transcription factors for applications such as cellular programming or cancer drug resistance. Protocols...Fu Z, Macrae RK, Buenrostro JD, Regev A, Zhang F. Cell 2023 Jan 5; 186(1):209-229. PubMed (Link opens in...
  7. Cancer Research Plasmids and Resources

    Type
    Collection
    ...important to normal cell signaling and physiology, and, when dysregulated, can enable cancer cell survival. Although...that is essential for regulating the growth of the cell. p53 p53, the most frequently mutated gene in human...somatic variants found in lung adenocarcinoma as well as variants found across cancer types as part of...
  8. Synthetic Biology - Overview

    Type
    Collection
    ...George Church Cynthia Collins James Collins Tom Ellis Drew Endy Tobias Erb Susan Golden John Gray Jeff... Keasling Taek Soon Lee Joshua Leonard Han Lim Wendell Lim Timothy Lu Michel Maharbiz Thorsten Mascher...Sensing and Signaling Browse plasmids related to intercellular signaling and environmental sensing. Strains... Circuit Transfer C. Collins Lab Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter...
  9. Adenovirus Plasmids

    Type
    Collection
    ...target a broad range of dividing and non-dividing cell types with almost 100% efficiency. Unlike lentiviruses...adenoviruses include transient transgene expression, as well as the substantial immune response induced by the...recombination of adenovirus plasmids in either mammalian cells or microorganisms, including bacteria and yeast....can then be transfected into mammalian packaging cell lines to generate adenovirus particles. Read our...
  10. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...e.g., pHelper) and specific packaging cell lines (e.g., HEK293 cells) during AAV production. Read our AAV...AAV can transduce both dividing and non-dividing cells with a low immune response and low toxicity. Although...in-stock preps that are ready to ship right away, as well as our Packaged on Request service to give you more...
  11. Validated gRNA Sequences

    Type
    Collection
    ... 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC 58982 cut S. pyogenes 24879462 Mello AXIN2 H. sapiens... compiled from plasmids in Addgene's database as well as from sequences provided to us by users (see below...GAACCCGTTGCCGAATACAC 58202 cut S. pyogenes 24879462 Mello unc-58(e665) C. elegans TCCACGCACATGGTCACTA 59931...GGATGGATGTGTAGTCAATT 61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut ...
  12. Optogenetics AAV Preps

    Type
    Collection
    ...pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell 135634 pAAV-S5E2-ChR2-...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...Fluorophore GFP Red-wavelength fluorescent protein Yellow-wavelength fluorescent protein Blue-wavelength ...
  13. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael ...Backbones mEmeralds Reds Blues Cyans Oranges Greens Yellows Photoactivatables Empty Backbones Plasmid Description...Description Industry Greens Plasmid Description Industry Yellows Plasmid Description Industry Photoactivatables ...
  14. NETRF

    Type
    Collection
    ... Modeling Neuroendocrine Tumors Using Adult Stem Cell-Derived Organoids Matthew Meyerson Dana-Farber Cancer...Institute Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Qiao Zhou Harvard University...University Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Bradley Bernstein Broad Institute...
  15. Depositor Collections

    Type
    Collection
    ...Collection Allen Institute for Cell Science Plasmid Collection New England BioLabs Cell-Imaging Plasmid Collection...Botman-Teusink Yeast FP Collection Protein Expression Cell Migration Consortium Malate Dehydrogenase CUREs ...
  16. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ...to activate programmed cell death or dormancy for phage-infected bacterial cells so as to limit the spread...population. Type VI enzymes that function in mammalian cells can be used to attentuate RNA levels. In mammalian...
  17. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ); a mechanism...introduced along with the Cas9 and gRNA plasmids, the cell may instead repair the break using homology-directed...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...
  18. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...
  19. CRISPR Plasmids - Parasites

    Type
    Collection
    ...developments with CRISPR-Cas9 gene editing have propelled both reverse and forward genetics of these parasites...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...
  20. TALEN Engineering

    Type
    Collection
    ...Tesson et al., Nat Biotechnol. 2011 ) Human somatic cells ( Miller et al., Nat Biotechnol. 2011 ; Reyon and...., Nat Biotechnol 2012 ) Human pluripotent stem cells ( Hockemeyer et al., Nat Biotechnol. 2011 ) TALE...TALE transcriptional activators in human cells ( Maeder et al., Nat Methods 2013 ) More detailed information...
Showing: 61 - 80 of 121 results