We narrowed to 139 results for: STI;
-
TypeCollection...NPY2R Human Mouse IgG2a 177465 Anti-Collybistin [L120/30R] Collybistin Rat Mouse IgG2a 177466 Anti-nNOS/...Alpha1 Human Mouse IgG2a 177575 Anti-Collybistin [L120/12R] Collybistin Rat Mouse IgG2a 182096 Anti-Kv2.1...IgG2a 225365 Collybistin (Rattus norvegicus) recombinant monoclonal antibody. Collybistin Rat Mouse IgG2a...BAIAP2 Human Mouse 190507 Collybistin scFv [L120/12] L120/12 scFv Collybistin Rat Mouse 190508 Bassoon ...R-mAbs have been engineered such that they are a distinct IgG subclass from the conventional mAb to facilitate...
-
Synthetic Biology - Overview
TypeCollection...Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium ...ethical synthetic biology JBEI - Joint Bio-Energy Institute Synberc - Synthetic Biology Engineering Research...Synthetic Biology - Open access journal Do you have suggestions for other plasmids that should be added to this... -
Worm Expression Resources
TypeCollection...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...on miniMos and MosSCI plasmids can be found on Christian Frøkjær-Jensen's Wormbuilder website. General ...organism C. elegans. Return to top Do you have suggestions for other plasmids that should be added to this... -
Validated gRNA Sequences
TypeCollection...Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740 Christiaen EGFP A. victoria...negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740 Christiaen negative control... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...changed the way researchers can explore important questions surrounding serine phosphorylation by adding this...improved phosphoprotein yield, rEcoli growth characteristics, and an overall improved ease of use when expressing...precise knowledge of phosphorylated positions for testing phosphoproteomics methods, proteomics search algorithms... -
CRISPR Plasmids - Tagging
TypeCollection...Genetics 2014 Allen Institute for Cell Science Plasmid Collection The Allen Institute for Cell Science has...and EGFP are available at Addgene. Do you have suggestions for other plasmids that should be added to this... -
Retrograde AAV viral preps
TypeCollection...construct from Alla Karpova at Janelia Research Institute....staining, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...vector preparation. In some cases, in vivo testing of these viral preparations was performed by the Karpova... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...For small deletions (as the “deletion band” may still amplify), resolve agarose gel to determine if size...for 20 min). These cycling conditions allow for digestion and ligation to occur in one reaction (see step...conditions for each primer pair designed based on testing the bulk sorted cells. Run samples on 2% agarose... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout ...Mutation Libraries 229137–229140 Donor Vector Human Stiewe N/A Varies 1,910–3,034 per exon Human Cas13 lncRNA...69,716 SAM v2 - 2 plasmid system 1000000078 (Blasticidin) Activation Human Zhang 3rd 3 70,290 sgRNA libraries... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Fluorescent Protein Resources: Empty Backbones Allen Institute for Cell Science Plasmid Collection FRET Biosensors...-pmCherryC1 Actin Filaments Cortactin mCherry Christien Merrifield 36201 pLifeAct-mTurquoise2 Actin Filaments...Protein Collection . Return to top Do you have suggestions for other plasmids that should be added to this...