Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 159 results for: LAS

Showing: 141 - 159 of 159 results

  1. Impact of Genomic Variation on Function (IGVF) Consortium Collection

    Type
    Collection
    ...and phenotype and shares their plasmid tools through Addgene. ID Plasmid Description Vector Type PI Publication...Browse plasmid tools generated by IGVF Consortium investigators to examine how genomic variation affects...genomic variants on genome function and phenotypes. Plasmids The collection will grow as the IGVF community...

  2. All Antibodies

    Type
    Collection
    ...provide important details including the protein and plasmid sequence, the antigen sequence, and cross-species...develop and refine these application lists. The plasmids we use to produce antibodies are available as ...as part of Addgene’s larger Antibody Plasmid Collection , which also includes other types of affinity reagents...? Check out our current collection of Antibody Plasmids , fill out our Suggest an Antibody form, or email...

  3. Recombinases AAV Preps

    Type
    Collection
    ...We provide high quality AAV preps from select plasmids in the repository. Browse our AAV collection of...used to control gene expression. See our Cre-lox Plasmids page for more information about these molecular...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need....

  4. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...Adenoviral Guide Viral Vector Plasmids and Resources Addgene Blog: Your Lentiviral Plasmid FAQs Biosafety Resource...reporter plasmids to test whether or not you've efficiently generated infectious virus, plasmids expressing...

  5. Zinc Finger Consortium: Nuclease Expression Vectors

    Type
    Collection
    ...This page lists plasmid vectors designed to express nucleases in different cell types. Zinc finger arrays... Plasmid Collections Zinc Finger Consortium Nuclease Expression...Consortium: Nuclease Expression Vectors This page lists plasmid vectors designed to express nucleases in different...

  6. Chemogenetics AAV Preps

    Type
    Collection
    ... in specific cell types. See our Chemogenetics Plasmids and Chemogenetics Guide pages for more information...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need....

  7. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ... Plasmid Collections Zinc Finger Consortium Zinc Finger ...encoding zinc finger arrays should be cloned into plasmids also available through Addgene--the specific vector...OPEN gCTCCCAACCactttGCTGGTGTCa dopamine beta hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc...

  8. Validated gRNA Sequences

    Type
    Collection
    ...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...Datatable Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...

  9. Control AAV Preps

    Type
    Collection
    ...We provide high quality AAV preps from select plasmids in the repository. Browse our control AAV collection...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need....

  10. Brain Armamentarium

    Type
    Collection
    ... BRAIN Armamentarium Project below. Plasmids ID Plasmid Description PI Viral Preps ID Viral Prep Description...underlie behavior and network function. Browse plasmids or viral preps created with support from the BRAIN...

  12. AAV Molecular Tools

    Type
    Collection
    ...Syn-driven, Cre-dependent Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling ...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need....

  13. Biosensor AAV Preps

    Type
    Collection
    ...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need....

  14. Tags and Other Markers

    Type
    Collection
    ...? Check out our current collection of Antibody Plasmids , fill out our Suggest an Antibody form, or e-...

  15. Neuroscience

    Type
    Collection
    ...? Check out our current collection of Antibody Plasmids , fill out our Suggest an Antibody form, or e-...

  16. NETRF

    Type
    Collection
    ...others to join their cause. Browse the available plasmids from the NETRF-funded investigators listed below...

  17. AAV Viral Preps

    Type
    Collection
    ... on Request service. You can choose a transfer plasmid from our repository and request packaging in one...

  18. AAV for Neuronal Tracing

    Type
    Collection
    ...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need....
Showing: 141 - 159 of 159 results