We narrowed to 13 results for: 683
-
TypeCollection...piRFP702-N1 miRFP703 673/703 8 pmiRFP703-N1 miRFP709 683/709 4 pmiRFP709-N1 iRFP (aka iRFP713) 690/713 6.2...
-
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Monomer pemiRFP703-N1 - Mammalian Expression miRFP709 683 709 4 4.5 Monomer pmiRFP709-N1 - Mammalian Expression...Expression pBAD/His-miRFP709 - Bacterial Expression mIFP 683 704 7 3.5 Monomer mIFP-N1 - Mammalian Expression ... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...Plasmid 68307 SupD Strain 68306 C321.ΔA.Δserb.Amp Plasmid 68305 Beta lactamase S68TAG Plasmid 68302 MBP-MEK1...-MEK1 S222TAG Plasmid 68301 MBP-MEK1 S218TAG Plasmid 68300 MBP-MEK1 Plasmid 68299 GFP E17TAG/Q157TAG Plasmid... strain of E. coli , C321.ΔA (Bacterial strain #68306) , with the optimized phosphoserine orthogonal translation...#68292) or serine using supD tRNA ( SupD (Plasmid #68307) ) at the central position. Introducing Hi-P for...be synthesized using supD tRNA ( SupD (Plasmid #68307) ) to generate the phosphosites with serine instead... -
Validated gRNA Sequences
TypeCollection...pyogenes 26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron ...pyogenes 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 Mammalian/Lentiviral hU6 none S. pyogenes Crimson... -
Neurodegeneration Plasmid Collection
TypeCollection...Root 76838 PRKAR1B gRNA (BRDN0001146606) PRKAR1B hU6 Dementia and/or parkinsonism David Root 76839 PRKAR1B... mEGFP-OPTN(F178A) OPTN GFP ALS Michael Lazarou 119683 pBMN mCherry-OPTN(D474N) OPTN mCherry ALS Michael... A1-LCD-10G+10S HNRNPA1 His T7 ALS Tanja Mittag 178683 A1-LCD-20G+20S HNRNPA1 His T7 ALS Tanja Mittag ...KCND2 CMV Spinocerebellar ataxia 18 James Trimmer 219683 CLIPf-KIF5A(1-573) KIF5A CLIPf CMV, T7 ALS Alison... -
Retrovirus Plasmids
TypeCollection...64865 pLncEXP CMV/MSV lncRNA expression plasmid Sun 60683 pLXIN-Luc MoMSV Stable expression of luciferase ... -
p53 Pathway
TypeCollection...7:57-68. doi: 10.2147/OTT.S53876. PubMed PMID: 24379683 . When mutants gain new powers: news from the ... -
Rett Syndrome
TypeCollection...67, 164–166. (Link opens in a new window) PMID: 16832102 Krishnaraj et al. 2017. RettBASE: Rett syndrome... -
Caltech Systemic Capsids
TypeCollection...with the pUCmini-iCAP-AAV9-X1.1 plasmid (Addgene #196836) . Browse Available AAV9-X1.1 ID Name Promoter ... -
Genetic Code Expansion
TypeCollection...restored so decreased mutation rate George Church 68306 C321.ΔA all TAG sites changes to UAG, RF1 function... -
Trimmer Lab NeuroMab Collection
TypeCollection...1] Kv4.2 K+ channel (external) Human Mouse IgG1 206683 Anti-CASPR/Neurexin IV [K65/35R-1] CASPR/Neurexin... -
Immunology Research Plasmids and Resources
TypeCollection... CD3E CD3e molecule, epsilon (CD3-TCR complex) FLJ18683, T3E, TCRE CD3G CD3g molecule, gamma (CD3-TCR ...