... PubMed . Return to AAV In vivo plasmids AAV Plasmids with Cas9 Mouse CRISPR-Cas9 knockin mice for genome... Blog Posts Jump to: SpCas9 Plasmids GeCKO SAM AAV - In vivo Delivery AAV - Cas9 Mouse CRISPR ( C lustered...sorting of cells and nuclei. Return to top AAV - Cas9 mouse CRISPR-Cas9 is a versatile genome editing technology...constitutively Cas9-expressing mouse. Described here are AAV vectors that can be combined with Cas9 in a wide... al., Nature Protocols 2013). SpCas9 Cas9: The PX551 plasmid (AAV-SpCas9, #60957) contains a single cassette...Return to top Cas9 SAM transcriptional activation plasmids and screening library CRISPR/Cas9 Synergistic...that allow the delivery of Cas9 and sgRNA in vivo via adeno-associated virus (AAV). The single vector system...

...organism without a specific preferred mutation Cas9 (or Cas9 nickase) Single (or dual) gRNA targeting 5′ ...generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base editor Single (or dual) gRNA ...concern, Cas9-gRNA ribonucleoprotein (RNP) complexes are advantageous due to the transient Cas9 expression... screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer vector and used...used to generate AAV particles (for details, see our AAV Guide ) ∼4.5 kb packaging limit (only compatible... RNA delivery of Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA and gRNA, which...generate transgenic embryos Cas9-gRNA ribonucleoprotein (RNP) complexes Purified Cas9 protein and in vitro transcribed...

... plasmid contains Cas9 and if so, which function of Cas9. We have plasmids with Cas9 that can cut, activate...Expression System Cloning Enzyme Co-expressed Cas9 Cas9 System Selection PI pCRISPR 42875 Bacteria BsaI...BbsI)_CBh-Cas9-T2A-BFP 64323 Mammalian BbsI yes, cut S. pyogenes BFP Kuhn pU6-(BbsI)_CBh-Cas9-T2A-mCherry...meningitidis Joung Cas9 sgRNA vector 68463 Mammalian U6 none S. pyogenes Zhang Cas9/pTREX-n 68708 Other...pX601 61591 Mammalian/AAV BsaI yes, cut S. aureus Zhang pX602 61593 Mammalian/AAV BsaI yes, cut S. aureus...independent U6 promoters and Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit for multiplex genome...cassettes are assembled into a Cas9 expressing vector. Yang A Robust CRISPR/Cas9 System for Convenient, High-Efficiency...

...107312 AAV-hSyn-mCherry-P2A-Cre-WPRE mCherry and Cre; expressed in neurons hSyn AAV Yang 107313 AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA...Cre-dependent Cas9: Cre-dependent Cas9 can be knocked in to a mouse at the Rosa26 locus to facilitate Cas9 mediated...Deisseroth 55635 pAAV-EF1a-sCre SCre EF-1 alpha AAV Deisseroth 55636 pAAV-EF1a-Cre Cre EF-1 alpha AAV Deisseroth...CamKII AAV Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Cre hSyn AAV Wilson 105555 pENN.AAV.hSyn.Cre.hGH Cre ...51507 AAV pmSyn1-EBFP-Cre Cre-EBFP fusion; Expression in neurons. synapsin AAV Zeng 51904 paavCAG-iCre ...iCre CAG AAV Kim 55632 pAAV-Ef1a-mCherry-IRES-Cre Cre and mCherry coexpression EF-1 alpha AAV Deisseroth...EGFP-Cre fusion hSyn AAV Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 EGFP-Cre fusion CMV AAV Wilson 105550 ...

...High fidelity Cas9s: Three high fidelity Cas9 variants , SpCas9-HF, eSpCas9, and HypaCas9 display very ...Staphylococcus aureus (SaCas9) is smaller than SpCas9 and more easily packaged in AAV. Cas9 orthologs also have...III and Cas9 enzymes, which together separate the individual crRNAs. (3) The tracrRNA and Cas9 nuclease...beyond SpCas9, moving us closer to being able to target every locus in every genome. Multiple Cas9 orthologs...capability of Cas9 to make other types of modifications at specific loci. Activate or Repress : dCas9 fused to...the crRNA would bind. (5) After the complex binds, Cas9 separates the double stranded DNA target and cleaves...Single multi-domain effector) Type I (Cas3) Type II (Cas9) Type III (Cas10) Type V (Cpf1) Type IV (Csf1) Type...

...contains Cas9. ID Plasmid Expression System Promoter Guide RNA Type Cloning Enzyme Co-expressed Cas9 Selection...transcriptase (RT) is fused to the C terminus of Cas9 H840A nickase. The fusion enzyme is capable of installing...template. During prime editing, the pegRNA directs the Cas9 nickase to the target sequence where it nicks the...nuclear localization signals, and two mutations in Cas9 to enhance nuclease activity; can be used in PE2...PE6 - small prime editors with optimized RT and/or Cas9 domains PE7 - addition of RNA-binding exonuclease...PuroTK-pegRNA_GG Mammalian, piggyBac hU6 pegRNA BsmBI Yes (Cas9 H840A + MMLV RT) PuroTK Jacob Giehm Mikkelsen 174038... RNA-H1-nick sgRNA-mCherry Mammalian, AAV hU6 + H1 pegRNA + nicking sgRNA No mCherry Hyongbum...

... Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent ... Nat Biotechnol. 2023 May 22. See More AAV Viral Preps Find AAV viral preps for systemic delivery of viral...research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies...species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base...brain cells and more. New and Noteworthy: AAV.rTH.PI.Cre.SV40 ready-to-use viral prep useful for dopamine...

...protein production AAV-GfaABC1D-MCS--4x6T-WPRE - For astrocyte-selective expression in AAV Dual promoter Separate...Advantages Representative Empty Backbones AAV High transduction efficiency, but do NOT integrate...expression, see our dedicated Adeno-associated Virus (AAV) Plasmids page Lentiviral Can transduce both dividing... Separate expression pRGEB31 - Deliver sgRNA and Cas9 into plants by Agrobacterium-mediated transformation...Express sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated... FP Collection NLS Nuclear localization dCas9 plasmid - dCas9 expression plasmid without effector fusions...

... available with multiple Cas9 variants, including high fidelity Cas9s, Cas9s with various PAM requirements...strand SpCas9-HF1 - disrupt Cas9’s interactions with DNA phosphate backbone HypaCas9 - increase Cas9 proofreading...new tools. Figure 3: Overview of Cas9n Nickase and dead Cas9 The two Cas9 nuclease domains, RuvC and HNH...enhanced specificity by engineering Cas9 into high fidelity Cas9s (hfCas9) . There is currently no defined...application. Cas9 Orthologs While SpCas9 is the most commonly used Cas enzyme, additional Cas9 orthologs ...constructs with Cas9 fused to proteins that modulate HDR or NHEJ components, like miCas9 , Cas9-DN1S , or others...Plasmids: Purify Cas9 Alternatives for CRISPR Genome Engineering S. pyogenes Cas9 (SpCas9) is the most commonly...

...Carrier Proteins (SLCs) from the RESOLUTE collection AAV Packaging from Addgene Parkinson's Research from ...Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation genome editing of human TP53...

...pX330S-2-PITCh - expresses Cas9 & PITCh-gRNA pX330A-FBL/PITCh - expresses Cas9, PITCh-gRNA, & FBL-specific...#79888) , which expresses an untagged Cas9 AND a gRNA targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG... consists of two components: A vector containing Cas9 and a validated gRNA, based on the Zhang lab's PX458...need to design and clone in a gRNA(s) to guide the Cas9 protein to your target sequence, as well as design...consists of two components: An all-in-one CRISPR/Cas9 vector based on the Zhang lab's PX330 , simultaneously... to generate both an expression cassette for the Cas9-programming sgRNA and HR donors for selectable genome...for integrating at the AAVS1 "safe harbor" locus: eSpCas9(1.1)_No_FLAG_AAVS1_T2 Doyon Lab TAP Tagging ...

...require the use of lentivirus to deliver the gRNA/Cas9 to target cells. Therefore, you must be equipped...86550 Inhibition Human Weissman 3rd 10 Varies CRISPR/Cas9-assisted Removal of Mitochondrial DNA (CARM) Library...113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286 Mouse Validation (mVAL) CRISPR Library 159391...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors... Sabatini and Lander 3rd 50 6,661 Garnett Lab MinLibCas9 Library 164896 Knockout Human Garnett 3rd 2 37,722...

...single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with targets that are upstream...activity. Know your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this gRNA sequence...and Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish....Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG...10 C. elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C. elegans GCTACCATAGGCACCACGAG...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...

...capabilities but are small enough to be packaged in AAV particles. Want more information on the wide variety...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...

...sgHTT51-7sk-Cas9 HTT U6, 7sk Huntington's Nicole Deglon 190902 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6...-FP Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 ...74170 pVEX-CC1 DCTN1 tac ALS Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637 ...Parkinson's Frank Soldner 180437 Px330-EGFP-LRRK2-CRISPR/Cas9 LRRK2 U6 Parkinson's Frank Soldner 180439 STR-KDEL_PGRN-SBP-mCherry...Hart 190900 pAAV2ss-U6-sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51...Parkinson's Hilal Lashuel 36055 pAAV asyn WT SNCA CMV Parkinson's Hilal Lashuel 36056 pAAV asyn S87A SNCA CMV Parkinson's...Hilal Lashuel 36066 pAAV asyn S129A SNCA CMV Parkinson's Patrick Aebischer 36067 pAAV asyn S129G SNCA CMV...