We narrowed to 13 results for: BFP
-
TypeCollection...dependent 9 Wickersham 137130 pAAV-Ef1a-Con/Foff 2.0-BFP EF1a BFP Cre dependent 8 Deisseroth 137133 pAAV-Ef1a-...dependent 1 Gradinaru 137131 pAAV-Ef1a-Coff/Fon-BFP EF1a BFP Flp dependent 8 Deisseroth 137134 pAAV-Ef1a-...dependent 8, rg* Deisseroth 137129 pAAV-Ef1a-Con/Fon-BFP EF1a BFP Cre and Flp dependent 8 Deisseroth 137132 pAAV-Ef1a-Con... dependent 1 Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Sanes 45186 AAV-EF1a-BbChT...
-
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...endosomes Rab5 mCherry Gia Voeltz 49147 BFP-Rab5 Early endosomes Rab5 BFP Gia Voeltz 61802 GFP-Rab5B Early endosomes...Sec61 mCherry Gia Voeltz 49154 BFP-Sec61 beta Endoplasmic Reticulum Sec61 BFP Gia Voeltz 73209 pcDNA3.1-kappa-myc-dL5... Snapp 68126 ERoxBFP Endoplasmic Reticulum ER retention signal oxBFP Erik Snapp 49150 BFP-KDEL Endoplasmic...St-Pierre 49151 mito-BFP Mitochondria mitochondrial targeting signal (COX4) TagBFP Gia Voeltz 55102 mCherry-Mito...TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-...James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc...James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson 12674 GFP-... -
Neurodegeneration Plasmid Collection
TypeCollection...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 WT] TARDBP CMV ALS Rajat Rohatgi 107840 pHBS1108 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 ∆CTD] TARDBP CMV ALS Rajat Rohatgi 107842 pHBS1138 [IBB-GFP-mCherry3E]-[BFP-P2A-...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 F-S] TARDBP CMV ALS Rajat Rohatgi 107844 pHBS1203 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 4xsigma] TARDBP CMV ALS Rajat Rohatgi 107846 pHBS1201 [IBB-GFP-mCherry3E]-[BFP-P2A-...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 N-Q] TARDBP CMV ALS Rajat Rohatgi 107848 pHBS1335 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309S] TARDBP CMV ALS Rajat Rohatgi 107850 pHBS1339 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309F] TARDBP CMV ALS Rajat Rohatgi 107852 pHBS1338 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43... -
CRISPR Plasmids - Prime Edit
TypeCollection...pDAS12222_U6-pegRNA-BFP Mammalian hU6 pegRNA BpiI for pegRNA, Esp31 for PBS-RT No BFP Ervin Welker Do you... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Kuhn pU6-(BbsI)_CBh-Cas9-T2A-BFP 64323 Mammalian BbsI yes, cut S. pyogenes BFP Kuhn pU6-(BbsI)_CBh-Cas9-T2A-mCherry...)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B 64218 Mammalian see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro...cut S. pyogenes Jacks pU6-sgRNA EF1Alpha-puro-T2A-BFP 60955 Mammalian/Lentiviral none S. pyogenes Puro ...N. meningitidis Pederson pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6 64220 Mammalian U6 yes, cut S. pyogenes...-U6gRNA(BbsI)-PGKpuro2ABFP 50946 Mammalian/Lentiviral BbsI none S. pyogenes Puro, TagBFP Yusa lentiGuide-Puro...gRNA_handle_U6t 49016 Mammalian SacI none S. pyogenes EBFP Lu pH1v1 60244 Mammalian Gibson none S. pyogenes... S. pyogenes Puro Maehr pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP 62348 Mammalian/Lentiviral BbsI none S. pyogenes... -
Deisseroth INTRSECT Collection
TypeCollection...137129 pAAV-Ef1a-Con/Fon-BFP Cre AND Flp Yes 137130 pAAV-Ef1a-Con/Foff 2.0-BFP Cre AND NOT Flp FRT/F5 Yes... Yes 137131 pAAV-Ef1a-Coff/Fon-BFP Flp AND NOT Cre Yes 137132 pAAV-Ef1a-Con/Fon-mCherry Cre AND Flp Yes... -
Validated gRNA Sequences
TypeCollection...ACAGTGGGGCCACTAGGGAC cut S. pyogenes 26789497 Corn BFP ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Expression EBFP2 383 448 17 4.5 Prone to dimerization pBad-EBFP2 - Bacterial Expression EBFP2-N1 - Mammalian...Mammalian Expression EBFP2-C1 - Mammalian Expression EBFP2-pBAD - Bacterial Expression moxBFP 385 448 17 Monomer...Sirius-N1 - Mammalian Expression SBFP2 380 446 13 Monomer (A206K) pSBFP2-C1 - Mammalian Expression Azurite...Bacterial Expression mTagBFP2 399 456 32 2.7 12 min Prone to dimerization mTagBFP2-pBAD - Bacterial Expression...-Azurite - Mammalian Lentiviral expression pB18cmBFPAzurite - Bacterial Expression mAzurite 383 450 14...Monomer (A206K) moxBFP - Mammalian Expression mKalama1 385 456 16 5.5 Monomer (A206K) pBad-mKalama1 - Bacterial... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection..., T7, araBAD, trp mTagBFP2-pBAD - Protein expression vector with C-terminal mTagBFP2 tag pNIC-GST-TEV-...plasmid expressing mCherry pBad-EBFP2 - Bacterial expression of EBFP2 blue fluorescent protein 35S-eGFP-nosT...mCherry selectable marker pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1... -
Recombinases AAV Preps
TypeCollection...AAV-pgk-Cre PGK none rg* Aebischer 51507 AAV pmSyn1-EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40... -
Brain Initiative Collection
TypeCollection...with pAAV-TREtight-mTagBFP2-B19G Ian Wickersham 100799-AAV1 pAAV-TREtight-mTagBFP2-B19G helper virus for... -
AAV for Neuronal Tracing
TypeCollection...rabies virus AAV1 Wickersham 100799 pAAV-TREtight-mTagBFP2-B19G AAV1 Wickersham Introduction to Rabies Virus-based... -
Tetracycline Inducible Expression
TypeCollection...monosynaptic tracing. To be coinjected with pAAV-TREtight-mTagBFP2-B19G ( Plasmid #100799 ). Ian Wickersham 172878...