Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Showing: 1 - 14 of 14 results
  1. Qi Lab CRISPR Page

    Type
    Collection
    ...plasmid 44247 pdCas9::BFP-humanized A catalytically inactive, human codon-optimized Cas9-BFP fusion expression...pHR-SFFV-dCas9-BFP Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFP 46911...to 2x NLS, tagBFP and a KRAB domain 46912 pMSCV-LTR-dCas9-VP64-BFP Human expression vector containing MSCV...46911 pHR-SFFV-dCas9-BFP-KRAB Human expression vector containing SFFV promoter, dCas9 that is fused to ...targeting human telomeres 46913 pMSCV-LTR-dCas9-p65AD-BFP Human expression vector containing MSCV LTR promoter...promoter, dCas9 that is fused to 2x NLS, VP64 and tagBFP 51023 pSLQ1658-dCas9-EGFP Human expression vector...that is fused to 2x NLS, p65 activation domain and tagBFP 46914 pU6-sgGFP-NT1 Human pSico-based U6 vector...
  2. Control AAV Preps

    Type
    Collection
    ...pAAV-Ef1a-Con/Fon-BFP EF1a BFP Cre and Flp dependent 8 Deisseroth 137130 pAAV-Ef1a-Con/Foff 2.0-BFP EF1a BFP Cre dependent...dependent 8 Deisseroth 137131 pAAV-Ef1a-Coff/Fon-BFP EF1a BFP Flp dependent 8 Deisseroth 137132 pAAV-Ef1a-...Brainbow Constructs 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre-dependent 9 Sanes 45186 AAV-EF1a-BbChT...
  3. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...endosomes Rab5 mCherry Gia Voeltz 49147 BFP-Rab5 Early endosomes Rab5 BFP Gia Voeltz 61802 GFP-Rab5B Early endosomes...Sec61 mCherry Gia Voeltz 49154 BFP-Sec61 beta Endoplasmic Reticulum Sec61 BFP Gia Voeltz 73209 pcDNA3.1-kappa-myc-dL5... Snapp 68126 ERoxBFP Endoplasmic Reticulum ER retention signal oxBFP Erik Snapp 49150 BFP-KDEL Endoplasmic...St-Pierre 49151 mito-BFP Mitochondria mitochondrial targeting signal (COX4) TagBFP Gia Voeltz 55102 mCherry-Mito...TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-...TagRFP James Johnson 79803 pTag-BFP-C-h-Rab7-c-Myc Late endosomes Rab7 TagBFP James Johnson 12605 GFP-rab7...James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 WT] TARDBP CMV ALS Rajat Rohatgi 107840 pHBS1108 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 deltaCTD] TARDBP CMV ALS Rajat Rohatgi 107842 pHBS1138 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 F-S] TARDBP CMV ALS Rajat Rohatgi 107844 pHBS1203 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 4xsigma] TARDBP CMV ALS Rajat Rohatgi 107846 pHBS1201 [IBB-GFP-mCherry3E]-[BFP-P2A-...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 N-Q] TARDBP CMV ALS Rajat Rohatgi 107848 pHBS1335 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309S] TARDBP CMV ALS Rajat Rohatgi 107850 pHBS1339 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309F] TARDBP CMV ALS Rajat Rohatgi 107852 pHBS1338 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...
  5. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...pDAS12222_U6-pegRNA-BFP Mammalian hU6 pegRNA BpiI for pegRNA, Esp31 for PBS-RT No BFP Ervin Welker Do you...
  6. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Kuhn pU6-(BbsI)_CBh-Cas9-T2A-BFP 64323 Mammalian BbsI yes, cut S. pyogenes BFP Kuhn pU6-(BbsI)_CBh-Cas9-T2A-mCherry...)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B 64218 Mammalian see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro...cut S. pyogenes Jacks pU6-sgRNA EF1Alpha-puro-T2A-BFP 60955 Mammalian/Lentiviral none S. pyogenes Puro ...N. meningitidis Pederson pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6 64220 Mammalian U6 yes, cut S. pyogenes...-U6gRNA(BbsI)-PGKpuro2ABFP 50946 Mammalian/Lentiviral BbsI none S. pyogenes Puro, TagBFP Yusa lentiGuide-Puro...gRNA_handle_U6t 49016 Mammalian SacI none S. pyogenes EBFP Lu pH1v1 60244 Mammalian Gibson none S. pyogenes... S. pyogenes Puro Maehr pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP 62348 Mammalian/Lentiviral BbsI none S. pyogenes...
  7. Deisseroth INTRSECT Collection

    Type
    Collection
    ... 137129 pAAV-Ef1a-Con/Fon-BFP Cre AND Flp 137130 pAAV-Ef1a-Con/Foff 2.0-BFP Cre AND NOT Flp FRT/F5 137131...137131 pAAV-Ef1a-Coff/Fon-BFP Flp AND NOT Cre 137132 pAAV-Ef1a-Con/Fon-mCherry Cre AND Flp 137133 pAAV-...
  8. Validated gRNA Sequences

    Type
    Collection
    ...ACAGTGGGGCCACTAGGGAC cut S. pyogenes 26789497 Corn BFP ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn...
  9. Cre-lox system

    Type
    Collection
    ...Cre Thy1 Mammalian Pelczar 51507 AAV pmSyn1-EBFP-Cre Cre-EBFP fusion; Expression in neurons. synapsin AAV...homology arms Mammalian Heller 113837 pCAGGS-mTagBFP2-T2A-iCre TagBFP, iCre CAG Mammalian Capecchi 113849 pCAGGS-pac-T2A-iCre...CAG Mammalian Capecchi 125822 pCAGGS-mTagBFP2-T2A-iCre (v2) TagBFP, iCre CAG Mammalian Capecchi 126006 ...Cre EF-1 alpha Lentiviral Kotton 128166 pCAGGS-mTagBFP2-T2A-sfGFP-iCre-ERT2 sfGFP-iCre-ERT2 (PAPGSTM N-terminus...inducible CAG Mammalian Capecchi 128167 pCAGGS-mTagBFP2-T2A-sfGFP-GSAx9-iCre-ERT2 sfGFP-iCre-ERT2 (PAPGSTM...inducible CAG Mammalian Capecchi 128168 pCAGGS-mTagBFP2-T2A-iCre-ERT2 iCre-ERT2 (PAPGSTMA N-terminus) ...inducible CAG Mammalian Capecchi 128171 pCAGGS-mTagBFP2-T2A-iCreERT2 (PV) iCre-ERT2 (PV N-terminus) - ...
  10. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression EBFP2 383 448 17 4.5 Prone to dimerization pBad-EBFP2 - Bacterial Expression EBFP2-N1 - Mammalian...Mammalian Expression EBFP2-C1 - Mammalian Expression EBFP2-pBAD - Bacterial Expression moxBFP 385 448 17 Monomer...Sirius-N1 - Mammalian Expression SBFP2 380 446 13 Monomer (A206K) pSBFP2-C1 - Mammalian Expression Azurite...Bacterial Expression mTagBFP2 399 456 32 2.7 12 min Prone to dimerization mTagBFP2-pBAD - Bacterial Expression...-Azurite - Mammalian Lentiviral expression pB18cmBFPAzurite - Bacterial Expression mAzurite 383 450 14...Monomer (A206K) moxBFP - Mammalian Expression mKalama1 385 456 16 5.5 Monomer (A206K) pBad-mKalama1 - Bacterial...
  11. Plasmids for Optogenetics Research

    Type
    Collection
    ...Boyden 123312 pcDNA3.1-ArchT-BFP2-TSERex Inhibitory ArchT Mammalian BFP2 Li 123607 pAAV-Syn-FLEX-rc [ArchT-tdTomato...mScarlet Harvey 124793 pcDNA3.1-Mac-BFP2-TSERex Inhibitory Mac Mammalian BFP2 Li 125255 plenti2-EF1a-ChR2-EYFP-WRPE...Campbell 87697 pcDNA-I-PhoCl-HCVp PhoCl Mammalian EBFP2 Campbell 89442 CRY2-GFP-homer1c Cry2-CIB1 Mammalian...
  12. Recombinases AAV Preps

    Type
    Collection
    ...Aebischer Synapsin Promoter 51507 AAV pmSyn1-EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40...
  13. Brain Initiative Collection

    Type
    Collection
    ...with pAAV-TREtight-mTagBFP2-B19G Ian Wickersham 100799-AAV1 pAAV-TREtight-mTagBFP2-B19G helper virus for...
  14. AAV for Neuronal Tracing

    Type
    Collection
    ...rabies virus AAV1 Wickersham 100799 pAAV-TREtight-mTagBFP2-B19G AAV1 Wickersham Introduction to Rabies Virus-based...
Showing: 1 - 14 of 14 results