Skip to main content

We narrowed to 14 results for: BFP

Showing: 1 - 14 of 14 results
  1. Control AAV Preps

    Type
    Collection
    ...Ian Wickersham 137130 pAAV-Ef1a-Con/Foff 2.0-BFP EF1a BFP Cre dependent 8 Karl Deisseroth 137133 pAAV-... Viviana Gradinaru 137131 pAAV-Ef1a-Coff/Fon-BFP EF1a BFP Flp dependent 8 Karl Deisseroth 137134 pAAV-...rg* Karl Deisseroth 137129 pAAV-Ef1a-Con/Fon-BFP EF1a BFP Cre and Flp dependent 8 Karl Deisseroth 137132...dependent 1, 5 Loren Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Joshua Sanes 45186 AAV-EF1a-BbChT...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...endosomes Rab5 mCherry Gia Voeltz 49147 BFP-Rab5 Early endosomes Rab5 BFP Gia Voeltz 61802 GFP-Rab5B Early endosomes...Sec61 mCherry Gia Voeltz 49154 BFP-Sec61 beta Endoplasmic Reticulum Sec61 BFP Gia Voeltz 73209 pcDNA3.1-kappa-myc-dL5... Snapp 68126 ERoxBFP Endoplasmic Reticulum ER retention signal oxBFP Erik Snapp 49150 BFP-KDEL Endoplasmic...St-Pierre 49151 mito-BFP Mitochondria mitochondrial targeting signal (COX4) TagBFP Gia Voeltz 55102 mCherry-Mito...TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-...James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc...James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson 12674 GFP-...
  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 WT] TARDBP CMV ALS Rajat Rohatgi 107840 pHBS1108 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 ∆CTD] TARDBP CMV ALS Rajat Rohatgi 107842 pHBS1138 [IBB-GFP-mCherry3E]-[BFP-P2A-...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 F-S] TARDBP CMV ALS Rajat Rohatgi 107844 pHBS1203 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 4xsigma] TARDBP CMV ALS Rajat Rohatgi 107846 pHBS1201 [IBB-GFP-mCherry3E]-[BFP-P2A-...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 N-Q] TARDBP CMV ALS Rajat Rohatgi 107848 pHBS1335 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309S] TARDBP CMV ALS Rajat Rohatgi 107850 pHBS1339 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309F] TARDBP CMV ALS Rajat Rohatgi 107852 pHBS1338 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43...
  4. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...pDAS12222_U6-pegRNA-BFP Mammalian hU6 pegRNA BpiI for pegRNA, Esp31 for PBS-RT No BFP Ervin Welker Return...
  5. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Kuhn pU6-(BbsI)_CBh-Cas9-T2A-BFP 64323 Mammalian BbsI yes, cut S. pyogenes BFP Kuhn pU6-(BbsI)_CBh-Cas9-T2A-mCherry...)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B 64218 Mammalian see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro...cut S. pyogenes Jacks pU6-sgRNA EF1Alpha-puro-T2A-BFP 60955 Mammalian/Lentiviral none S. pyogenes Puro ...N. meningitidis Pederson pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6 64220 Mammalian U6 yes, cut S. pyogenes...-U6gRNA(BbsI)-PGKpuro2ABFP 50946 Mammalian/Lentiviral BbsI none S. pyogenes Puro, TagBFP Yusa lentiGuide-Puro...gRNA_handle_U6t 49016 Mammalian SacI none S. pyogenes EBFP Lu pH1v1 60244 Mammalian Gibson none S. pyogenes... S. pyogenes Puro Maehr pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP 62348 Mammalian/Lentiviral BbsI none S. pyogenes...
  6. Deisseroth INTRSECT Collection

    Type
    Collection
    ...137129 pAAV-Ef1a-Con/Fon-BFP Cre AND Flp Yes 137130 pAAV-Ef1a-Con/Foff 2.0-BFP Cre AND NOT Flp FRT/F5 Yes... Yes 137131 pAAV-Ef1a-Coff/Fon-BFP Flp AND NOT Cre Yes 137132 pAAV-Ef1a-Con/Fon-mCherry Cre AND Flp Yes...
  7. Validated gRNA Sequences

    Type
    Collection
    ...ACAGTGGGGCCACTAGGGAC cut S. pyogenes 26789497 Corn BFP ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn...
  8. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression EBFP2 383 448 18 5.3 25 min Prone to dimerization pBad-EBFP2 - Bacterial Expression EBFP2-N1 - Mammalian...Mammalian Expression EBFP2-C1 - Mammalian Expression EBFP2-pBAD - Bacterial Expression moxBFP 385 448 17 Monomer...Sirius-N1 - Mammalian Expression SBFP2 380 446 16 5.5 Monomer (A206K) pSBFP2-C1 - Mammalian Expression Azurite...Bacterial Expression mTagBFP2 399 456 32 2.7 12 min Prone to dimerization mTagBFP2-pBAD - Bacterial Expression...-Azurite - Mammalian Lentiviral expression pB18cmBFPAzurite - Bacterial Expression mAzurite 383 450 14...Monomer (A206K) moxBFP - Mammalian Expression mKalama1 385 456 16 5.5 Monomer (A206K) pBad-mKalama1 - Bacterial...
  9. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ..., T7, araBAD, trp mTagBFP2-pBAD - Protein expression vector with C-terminal mTagBFP2 tag pNIC-GST-TEV-...plasmid expressing mCherry pBad-EBFP2 - Bacterial expression of EBFP2 blue fluorescent protein 35S-eGFP-nosT...mCherry selectable marker pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1...
  10. Recombinases AAV Preps

    Type
    Collection
    ...none rg* Patrick Aebischer 51507 AAV pmSyn1-EBFP-Cre Syn EBFP 5 Hongkui Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40...
  11. Fluorescent Proteins: FRET

    Type
    Collection
    ...QY A R 0 J(λ) Plasmids mTagBFP sfGFP 399 0.64 510 83,000 0.65 4.6 2.6 mTagBFP2-pBAD , sfGFP-pBAD ECFP ...
  12. Brain Initiative Collection

    Type
    Collection
    ...with pAAV-TREtight-mTagBFP2-B19G Ian Wickersham 100799-AAV1 pAAV-TREtight-mTagBFP2-B19G helper virus for...
  13. AAV for Neuronal Tracing

    Type
    Collection
    ...virus AAV1 Ian Wickersham 100799 pAAV-TREtight-mTagBFP2-B19G AAV1 Ian Wickersham Introduction to Rabies...
  14. Tetracycline Inducible Expression

    Type
    Collection
    ...monosynaptic tracing. To be coinjected with pAAV-TREtight-mTagBFP2-B19G ( Plasmid #100799 ). Ian Wickersham 172878...
Showing: 1 - 14 of 14 results