We narrowed to 5 results for: DST;
-
TypeCollection...SapTrap-SEC kit for C. elegans genome engineering - Bob Goldstein Lab. Contains a set of plasmids for building ...information regarding this kit can be found at the Goldstein Lab website . SapTrap CRISPR/Cas Toolkit - Erik...
-
CRISPR References and Information
TypeCollection... 110 KB Goldstein Nematode: gRNA design and cloning Cas9-sgRNA construct PDF, 364 KB Goldstein Nematode... -
CRISPR Plasmids - C. elegans
TypeCollection...Peft-3::Cas9 + Empty sgRNA) R07E5.16 U6 yes, cut Goldstein 42250 DR274 T7 BsaI In vitro transcription none... -
Validated gRNA Sequences
TypeCollection...ATATCAGTCTGTTTCGTAA 47550 cut S. pyogenes 23995389 Goldstein tyr D. rerio CCCCAGAAGTCCTCCAGTCC 46761 cut S.... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes Joung...