Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 6 results for: Folding Reporter GFP

Showing: 1 - 6 of 6 results

  1. Viral Production

    Type
    Collection
    ... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...that titers obtained using ddPCR are generally 2–3 fold higher than those achieved using the standard qPCR...expression and/or function. These data are sometimes reported or posted on the material page for the corresponding...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral...recipient's initial thaw will be accounted for in our reported titers. Lentiviral vectors are titered using a...

  2. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation process by a novel reporter protein... DsRed1-E5 as a reporter for mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial...Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters via electrochromic...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...

  3. Tetracycline Inducible Expression

    Type
    Collection
    ...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...al., 2006). Tet-On 3G systems can achieve >10,000-fold induction of the gene of interest. Tight TRE promoter...efficacy by fluorescence, use Plasmid #35626 as a reporter for cDNA target. rtTA3 Ptet, miniCMV Howard Gu...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...

  4. Neurodegeneration Research Collection

    Type
    Collection
    ... S A. 2023 Aug 22. Use a lentiviral FRET-based reporter to study tau seeding in mammalian cells. Lathuiliere...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ... (AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell.... These glutamine-rich sequences are prone to misfolding and aggregation and can interfere with protein-protein...

  5. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...

  6. CRISPR Guide

    Type
    Collection
    ...and a ssDNA-fluorescently quenched reporter is added. As this reporter is degraded by Cas12a, it will release... using a fluorescent reporter. In SHERLOCK, a quenched ssRNA fluorescent reporter is added to the reaction...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence... target sequence, it promiscuously cleaves the reporter as well, and a quantifiable signal is produced...all-in-one CRISPR/Cas9 vector system. Scientific Reports , 4 (1). PMID: 24954249 Shechner, D. M., Hacisuleyman...mapping multiprotein complexes in human cells. Cell Reports . 13 (3), 621–633. PMID: 26456817 Doench, J. G....The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-...
Showing: 1 - 6 of 6 results