Skip to main content
Addgene
Showing: 1 - 5 of 5 results

  1. Qi Lab CRISPR Page

    Type
    Collection
    ... pU6-sgGFP-NT1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)... pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter... pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter...pSLQ1658-dCas9-EGFP Human expression vector containing dCas9 that is fused to 2x NLS and EGFP for CRISPR ...targeting endogenous CD71 gene 46919 pMLS-SV40-EGFP Target EGFP gene that is stably integrated into HEK293...

  2. Worm Expression Resources

    Type
    Collection
    ...Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system in C. elegans . Synthetic Biology Synthetic...vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...

  3. Validated gRNA Sequences

    Type
    Collection
    ... Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...

  4. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP DEST - ...Fluorescent proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression...genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable...Plant Plasmids and Resources collection page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ...- Epitope tagging in S. pombe Insect/Baculovirus UAS, MT, Polyhedrin Targeted Gene Expression...fusing your protein to another protein, such as GFP, which allows you to visualize the cellular localization... cells, integrate into host genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for ...

  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
Showing: 1 - 5 of 5 results