Skip to main content
Addgene

We narrowed to 6 results for: PRK

Showing: 1 - 6 of 6 results
  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted Dawson 17613 pRK5-HA-Parkin PRKN HA CMV Parkinson's...23376 pDONR223-PRKAR1B PRKAR1B Dementia and/or parkinsonism William Hahn 23452 pDONR223-PRKR EIF2AK2 VWM ...38248 pMXs-IP HA-Parkin PRKN HA Parkinson's Noboru Mizushima 38938 PRKCG PRKCG His, TEV T7 Spinocerebellar...76840 PRKAR1B gRNA (BRDN0001147089) PRKAR1B hU6 Dementia and/or parkinsonism David Root 76898 PRKCG gRNA...BRDN0001147740) PRKCG hU6 Spinocerebellar ataxia 19 David Root 76899 PRKCG gRNA (BRDN0001146492) PRKCG hU6 Spinocerebellar... PKC gamma PRKCG MTH Spinocerebellar ataxia 30 Frederic Mushinski 8418 pLTR PKC gamma PRKCG Spinocerebellar...PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma PRKCG GFP CMV Spinocerebellar...
  2. MAPK Plasmids

    Type
    Collection
    ...P44MAPK, PRKM3, p44-ERK1, p44-MAPK MAPK4 ERK3, Erk4, PRKM4, p63MAPK MAPK6 ERK3, HsT17250, PRKM6, p97MAPK...ERT1, MAPK2, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk MAPK3 ERK-1, ERK1, ERT2...ERK4, ERK5, PRKM7 MAPK8 JNK, JNK-46, JNK1, JNK1A2, JNK21B1/2, PRKM8, SAPK1, SAPK1c... PRKM10, SAPK1b, p493F12, p54bSAPK MAPK11 P38B, P38BETA2, PRKM11, SAPK2...P38GAMMA, PRKM12, SAPK-3, SAPK3 MAPK13 RP1-179N16.4, MAPK 13, MAPK-13, PRKM13, SAPK4... CSBP2, CSPB1, EXIP, Mxi2, PRKM14, PRKM15, RK, SAPK2A, p38, p38ALPHA MAPK15...JNK2ALPHA, JNK2B, JNK2BETA, PRKM9, SAPK, SAPK1a, p54a, p54aSAPK...
  3. Ras Pathway

    Type
    Collection
    ...trisphosphate-dependent Rac exchange factor 2 PRKA PRKAA1 PRKAA2 PRKAB1 PRKAB2 PRKAG1 PRKAG2 PRKAG3 Protein kinase AMP-activated...
  4. Immunology Research Plasmids and Resources

    Type
    Collection
    ... isoform PPP3RL PRKCB protein kinase C, beta MGC41878, PKC-beta, PKCB, PRKCB1, PRKCB2 PTPN6 protein tyrosine...PFN1, PFP PRKCA protein kinase C, alpha AAG6, MGC129900, MGC129901, PKC-alpha, PKCA, PRKACA PRKCB protein...kinase C, beta MGC41878, PKC-beta, PKCB, PRKCB1, PRKCB2 PRKCG protein kinase C, gamma MGC57564, PKC-gamma...PKB-ALPHA, PRKBA, RAC, RAC-ALPHA AKT2 v-akt murine thymoma viral oncogene homolog 2 PKBB, PKBBETA, PRKBB, RAC-BETA... opioid receptor, delta 1 OPRD OPRK1 opioid receptor, kappa 1 KOR, OPRK OPRL1 opiate receptor-like 1 KOR...MKK1, PRKMK1 MAP2K2 mitogen-activated protein kinase kinase 2 FLJ26075, MAPKK2, MEK2, MKK2, PRKMK2 MAPK1...protein kinase 1 ERK, ERK2, ERT1, MAPK2, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk MAPK3 mitogen-activated...
  5. Validated gRNA Sequences

    Type
    Collection
    ...Bornhauser Prkaa1 M. musculus TTATTGTCACAGGCATATGG 79004 cut S. pyogenes 26944679 Shaw Prkaa2 M. musculus...
  6. CRISPR References and Information

    Type
    Collection
    ...opens in a new window) Ranks and picks candidate CRISPRko/a/i sgRNA sequences to maximize on-target activity...
Showing: 1 - 6 of 6 results