We narrowed to 45 results for: She;
-
TypeCollection... enhancer element Gordon Fishell 83894-AAV2 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent... enhancer element Gordon Fishell 83894-AAV5 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent... enhancer element Gordon Fishell 83894-AAV9 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent... enhancer element Gordon Fishell 83894-AAVrg pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent...hDlx enhancer element Gordon Fishell 83895-AAV1 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP...hDlx enhancer element Gordon Fishell 83895-AAV2 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP...hDlx enhancer element Gordon Fishell 83895-AAV8 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP...
-
Brain Armamentarium
TypeCollection...cell-targeting enhancer. Alias: pAAV_WDC0004_eGFP Gordon Fishell James M. Wilson 221463-PHPeB pAAV_BiPVe4_eGFP AAV...cell-targeting enhancer. Alias: pAAV_WDC0004_eGFP Gordon Fishell Viviana Gradinaru 218792-AAV1 pAAV_BiLAMP5e3_dTomato_nlsdTomato... Alias: pAAV_WDL0003_dTomato_nlsdTomato Gordon Fishell James M. Wilson 218792-PHPeB pAAV_BiLAMP5e3_dTomato_nlsdTomato... Alias: pAAV_WDL0003_dTomato_nlsdTomato Gordon Fishell Viviana Gradinaru 214869-PHPeB AiP15140: pAAV-AiE0873m...interneuron-targeting enhancer. Alias: pAAV_WDS0004_GCaMP6f Gordon Fishell James M. Wilson 213947-PHPeB pAAV_BiSSTe4_GCaMP6f...interneuron-targeting enhancer. Alias: pAAV_WDS0004_GCaMP6f Gordon Fishell Viviana Gradinaru 213945-AAV1 pAAV_BiSSTe4_ChR2...driven by SST interneuron-targeting enhancer Gordon Fishell James M. Wilson 213945-PHPeB pAAV_BiSSTe4_ChR2_... -
Genetic Code Expansion
TypeCollection... TAG Wenshe Liu 127415 pEVOL-AcKRS-CloDF PylRS M. mazei acyl-lysine derivatives Bacterial Wenshe Liu 127445...Bacterial Wenshe Liu 137908 PylRS-AS PylRS M. mazei fluorophenylalanine derivatives Bacterial TAG Wenshe Liu...Mammalian TAG Abhishek Chatterjee 217365 pIDTSmart-CMV-PLRS1 LeuRS E. coli Mammalian Abhishek Chatterjee ...consider. If you are working off of a previously established protocol, make sure to match the growth medium... pEVOL-AckRS PylRS M. mazei AzHeK Bacterial TAG Wenshe Liu 140009 pAS_4xMma PylT_FLAG-Mma PylRS PylRS ...pEVOL-pylT-AznLRS AznLRS M. mazei azidonorleucine Bacterial TAG Wenshe Liu 173897 SepRS(2)/pSertRNA(B4)/EF-Sep aminoacyl-tRNA...pEVOL-MmAcKRS1-PylTUUA PylRS M. mazei Bacterial TAA Wenshe Liu 182652 pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS... -
Caltech Systemic Capsids
TypeCollection...Control Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 99130 pAAV-mDlx-NLS-mRuby2 Dlx mRuby2...Control Fishell 213829 pAAV_BiCHATe27_dTomato_nlsdTomato BiCHATe27 dTomato/nlsdTomato Control Fishell 213855...Control Fishell 213936 pAAV_BiPVe4_dTomato_nlsdTomato BiPVe4 dTomato/nlsdTomato Control Fishell 213940 ...Control Fishell 213944 pAAV_BiSSTe4_dTomato_nlsdTomato BiSSTe4 dTomato/nlsdTomato Control Fishell Chemogenetics...Activator ChR2 Fishell 213830 pAAV_BiCHATe27_ChR2_mCherry BiCHATe27 Activator ChR2 Fishell 213856 pAAV_BiVIPe4...Activator ChR2 Fishell 213915 pAAV_BiLAMP5e3_ChR2_mCherry BiLAMP5e3 Activator ChR2 Fishell 213937 pAAV_BiPVe4... Activator ChR2 Fishell 213941 pAAV_BiPVe3_ChR2_mCherry BiPVe3 Activator ChR2 Fishell 213945 pAAV_BiSSTe4... -
Retrograde AAV viral preps
TypeCollection...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Gordon Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control...Control Gordon Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Gordon Fishell 104055 pAAV-CAG-eYFP...pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hDlx Inhibitor DREADD Gordon Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hDlx ...83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx Activator Optogenetics Gordon Fishell 65014 pAAV-hsyn-Jaws-KGC-GFP-ER2...Calcium sensor Jonathan Ting 83899 pAAV-mDlx-GCaMP6f-Fishell-2 mDlx GCaMP6f expression under the control of ...the mDlx enhancer element Calcium sensor Gordon Fishell 51084 AAV-hSyn1-GCaMP6s-P2A-nls-dTomato Syn GCaMP6s...hDlx Activator DREADD Gordon Fishell 98747 pAAV-FLEX-EGFPL10a EF1a EGFPL10a, Cre-dependent Molecular Tool... -
Neurodegeneration Plasmid Collection
TypeCollection...Huntington's Michael Sherman 1385 pYES2/103Q HTT Flag, GFP GAL1 Huntington's Michael Sherman 8412 pMTH PKC gamma...CMV ALS Elizabeth Fisher 26398 pF152 pcDNA3.1(+)SOD1A4V SOD1 CMV ALS Elizabeth Fisher 26399 pF153 pcDNA3.1...CMV ALS Elizabeth Fisher 26400 pF154 pcDNA3.1(+)SOD1G85R SOD1 CMV ALS Elizabeth Fisher 26401 pF155 pcDNA3.1...CMV ALS Elizabeth Fisher 26402 pF141 pAcGFP1 SOD1WT SOD1 GFP CMV ALS Elizabeth Fisher 26403 pF142 pAcGFP1...CMV ALS Elizabeth Fisher 26404 pF143 pAcGFP1 SOD1G37R SOD1 GFP CMV ALS Elizabeth Fisher 26405 pF144 pAcGFP1...CMV ALS Elizabeth Fisher 26406 pF145 pAcGFP1 SOD1G93A SOD1 GFP CMV ALS Elizabeth Fisher 26407 pF146 pSOD1WTAcGFP1...CMV ALS Elizabeth Fisher 26408 pF147 pSOD1A4VAcGFP1 SOD1 GFP CMV ALS Elizabeth Fisher 26409 pF148 pSOD1G37RAcGFP1... -
Control AAV Preps
TypeCollection... pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Gordon Fishell 99130 pAAV-mDlx-NLS-mRuby2... pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Gordon Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell...pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Gordon Fishell 100043 pAAV.synP.DIO.EGFP.WPRE.hGH... -
Rett Syndrome
TypeCollection...Mouse line with conditional deletion of Xist Unpublished Joost Gribnau Human Cell Line Models Induced ....806delG 806delG G269Afs*20 M Fibroblasts & iPSC Unpublished (Link opens in a new window) Wendy Gold A140V...A140V C419T A140V M Fibroblasts Unpublished (Link opens in a new window) Wendy Gold AN_BU 808delC Arg270Glufs...Arg270Glufs*19 F Fibroblasts & iPSC Unpublished (Link opens in a new window) Wendy Gold BO_DI 806delG G269Afs...G269Afs*20 F Fibroblasts Unpublished (Link opens in a new window) Wendy Gold HO_AN G917A R306H F Fibroblasts...Fibroblasts Unpublished (Link opens in a new window) Wendy Gold For more information on generating iPSCs using... -
E11 Bio PRISM Collection
TypeCollection...mouse hippocampus using PRISM. Adapted from Park & Sheridan et al. (2025). PRISM is part of an integrated ...separately for additional applications. Park & Sheridan et al. (2025) use plasmids expressing the barcode...dye-conjugated secondary antibody (as listed in Park & Sheridan et al., 2025). These reagents have been used in...neurons with machine learning. Adapted from Park & Sheridan et al. (2025). PRISM Plasmids ID Plasmid Description...information about PRISM, see the preprint: Park, S.Y., Sheridan, A., An, B., Jarvis, E., Lyudchik, J., Patton,... -
Validated gRNA Sequences
TypeCollection...26527385 Sherwood Pal7 synthetic GGCTTAGTACTAGTACTAAGC 71484 cut S. pyogenes 26527385 Sherwood PAX6 H. ...GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA...our datatable, please download the following spreadsheet, fill out as much information as possible on ....org with the subject heading "gRNA sequence spreadsheet". Thanks for helping us expand and improve our... resources! Download validated gRNA sequence spreadsheet... -
Chemogenetics AAV Preps
TypeCollection...pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Gordon Fishell 83897 pAAV-hDlx-GqDREADD-dTomato-Fishell...pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Gordon Fishell 50472 pAAV-GFAP-HA-rM3D... -
CRISPR Guide
TypeCollection...platform, termed SHERLOCK, can identify target sequences using a fluorescent reporter. In SHERLOCK, a quenched... the presence of that specific target. SHERLOCK (and SHERLOCKv2) allows for greater amplification and ...bacterial cells and does not occur in mammalian cells. SHERLOCK , developed by the Feng Zhang lab , is a Cas13a-based...flow strips. Other Cas enzymes can be added to SHERLOCKv2 to detect multiple targets. For example, Cas12...Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., & ...system. Scientific Reports , 4 (1). PMID: 24954249 Shechner, D. M., Hacisuleyman, E., Younger, S. T., & Rinn... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection.... pyogenes Matlashewski pSPneoHHgRNAH 63557 Other/Leishmania none S. pyogenes Matlashewski pLH-spsgRNA2...52256 Plant AscI, PacI, SbfI yes, cut S. pyogenes Sheen pT7-gRNA 46759 Zebrafish BsmBI none S. pyogenes ...-gRNA 52255 Plant PCR template none S. pyogenes Sheen pRGEB31 51295 Plant BsaI none S. pyogenes Yang pRPR1...2xBbsI-sgRNA-HygR) 71485 Mammalian none S. pyogenes Hygro Sherwood pMpGE_En01 71534 Other/Marchantia polymorpha MpU6... -
TALEN Guide
TypeCollection...CRISPR Plasmids Zinc Finger Consortium Originally published in Addgene's December 2011 Newsletter Overview...Halle-Wittenberg and Adam Bogdanove at Iowa State University published the nucleotide recognition code of the TAL effectors... before the end of the year. Dr. Zhang ‘s lab published a paper on TAL effectors in Nature Biotechnology... -
COVID-19 Resources
TypeCollection...Industry PI Addgene blog Finding nucleic acids with SHERLOCK and DETECTR No Llamas Required - Synthetic Nanobodies...diagnostics: DETECTR (Link opens in a new window) SHERLOCK (Link opens in a new window) Addgene's Protocol...coronaviruses (DOCX, 184 KB) Research Articles Many publishers allow free access to articles related to SARS-CoV... -
Antibody Guide
TypeCollection...the number of signaling molecules that can be distinguished in your application. The indirect detection ...Cross-link the samples with formaldehyde or UV light. Shear the samples using sonication to break DNA up into...protein. Micrococcal nuclease digestion is used to shear the DNA in these assays. This method is suitable...specific to your antibody and assay may already be published. If it is not, you’ll need to validate the antibody... -
CRISPR Plasmids - gRNAs
TypeCollection...note that the following table lists both published and unpublished plasmids containing gRNA sequences designed... -
Botman-Teusink Yeast FP Collection
TypeCollection...These vectors are based on the pFA6a-link plasmid (Sheff et al., 2004; Lee et al., 2013), and are available...window) PMID: 17293878 (Link opens in a new window) Sheff, M. A., Thorn, K. S. (2004). Optimized cassettes... -
AAV Packaged on Request
TypeCollection...often goes unshared, bridging the gap between published methods and real-world troubleshooting. Eligible...with troubleshooting and results that complement published data, capturing the insights that often go unshared... -
Zebrafish Plasmid Collection
TypeCollection... fish in the minnow family. It has long been established as a powerful vertebrate model organism for the...combinatorial and cumulative genome editing - Jay Shendure Lab Simultaneous single-cell profiling of lineages...