We narrowed to 5 results for: Tef
-
TypeCollection... Hanna TEF S. cerevisiae TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim TEF1 S. cerevisiae...
-
Botman-Teusink Yeast FP Collection
TypeCollection...p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km ...Km plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid... -
NETRF
TypeCollection...academic researchers around the world. The NETRF is grateful for the generous support of philanthropic individuals... -
TALEN Plasmids and Kits
TypeCollection...galactose-inducible expression. pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs... -
Neurodegeneration Plasmid Collection
TypeCollection...-12 splicing minigene MAPT CMV Parkinson's, FTD Stefan Stamm 121992 pHBS941 TDP43 RRM-GFP VLIMFYW-S TARDBP...