Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 38 results for: Tef

Showing: 1 - 20 of 38 results

  1. Validated gRNA Sequences

    Type
    Collection
    ... Hanna TEF S. cerevisiae TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim TEF1 S. cerevisiae...

  2. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km ...Km plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid...

  3. Embracing Serendipity: A Crucial Element in the PhD Journey

    Type
    Blog Post
    ...my career and life where I excel (and thus feel grateful) and identify areas in need of improvement. These... the world solely through logic and adopting a grateful, wonder-filled perspective that recognizes marvel...

  5. PiggyBac-ing Through the Genome Editing Field

    Type
    Blog Post
    ...PMCID: PMC4663986. 2.  A. M. Singh, V. V Adjan Steffey, T. Yeshi, and D. W. Allison, “Gene Editing in ...PMC4686154. 3. A. M. Singh, D. W. Perry, V. V. A. Steffey, K. Miller, and D. W. Allison, “Decoding the Epigenetic...

  6. NETRF

    Type
    Collection
    ...academic researchers around the world. The NETRF is grateful for the generous support of philanthropic individuals...

  7. Addgene's 20th Anniversary Party

    Type
    Blog Post
    ...individuals that makes Addgene — well, Addgene. We're so grateful for each and every one of you!  Throughout the...

  13. TALEN Plasmids and Kits

    Type
    Collection
    ...galactose-inducible expression. pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs...
Showing: 1 - 20 of 38 results