We narrowed to 23 results for: c myc plasmid
-
TypeCollection... Plasmid Collections Plasmids for Stem Cell Research Plasmids for Stem Cell Research...Reprogramming Plasmids Differentiation and Transdifferentiation Plasmids Stem Cell Research Plasmids Stem cells... human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-inducible system for ... mini-intronic plasmid (MIP) polycistronic expression of human Oct4, Klf4, Sox2, c-Myc and hairpin RNA... of human Sox2, Oct3/4, Klf4, and c-Myc from four separate plasmids Induction of pluripotent stem cells...human Klf4, Oct4, Sox2, c-Myc, and Lin28A to somatic cells from separate plasmids Highly Efficient Reprogramming...expression of mouse Sox2, Oct4, c-Myc, and Klf4 from four separate adenoviral plasmids Induced Pluripotent Stem...
-
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early ...pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling...-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc ...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...pCMV-mGold-Tubulin-C-18 Microtubules alpha-tubulin mGold Francois St-Pierre 158009 pCMV-mGold-Actin-C-18 Actin ...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization... Plasmid Collections Fluorescent Proteins Organelle Markers... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...display vector with a C-terminal Myc tag pPMW-attB - pUASp plasmid with N-terminal Myc tag and attB for Drosophila...N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial vector for Myc tag pETcon(-) - Yeast...transformation plasmids with G418 selection Find nematode transgenesis plasmids with Neomycin selection Puromycin... Plasmid Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Empty backbones...vector for C-terminal 3x HA tag fusion with your gene of interest in plants Myc Epitope tag pKMyc - N-terminal...transgenesis His Epitope tag pEZYmyc-His - C-terminal Myc-His tag for mammalian expression...Collection NLS Nuclear localization dCas9 plasmid - dCas9 expression plasmid without effector fusions; 3X Flag... -
Neurodegeneration Plasmid Collection
TypeCollection...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...D1994S)-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161585 pPuro3.1(+)_Strep-Lrrk2(G2019S)-Myc LRRK2... -
Luciferase Plasmid Collection
TypeCollection...Luciferase Plasmids Luciferase Plasmid Collection Empty Backbones Expression Constructs Reporter Constructs...otherwise noted, these plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s...preparations of select luciferase expression plasmids. ID Plasmid Luciferase Type Promoter Description PI ...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. ...of luciferase plasmids for gene expression assays and bioluminescent reporters. Plasmid... Plasmid Collections Luciferase... -
Tetracycline Inducible Expression
TypeCollection...Mammalian shRNA Plasmids Collection Cre-lox Plasmids Collection Stem Cell Research Plasmids Collection Tetracycline...selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection. TetR H1-2O2 Cindy .... ID Plasmid Description Transactivator Promoter PI 21915 Tet-pLKO-puro Lentiviral Tet-On plasmid for ...search our collection for all dox-regulated plasmids . ID Plasmid Description PI 63800 PB-TRE-dCas9-VPR Tet-inducible...Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2 Piggybac Tet-On plasmid for differentiating...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives... -
Cre-lox system
TypeCollection... Plasmid Collections Cre-lox Plasmids Cre-lox Plasmids Additional...Cre-lox Plasmids Addgene's Blog: Cre-lox Addgene's Blog: FLEx Vectors Cre-containing Plasmids loxP Constructs...viral preparations of plasmids that are currently in our repository. ID Plasmid Description Promoter Expression...Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed in rod photorecetor...loxP plasmids, reporter genes indicate which cells have undergone Cre recombination. These plasmids can...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail... Cre-lox plasmids for your experiments. Plasmid... -
CRISPR Pooled gRNA Libraries
TypeCollection... (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637 Broad GPP Humagne Set C and... - 3 plasmid system 1000000075 (Puromycin) Activation Mouse Zhang 3rd 3 69,716 SAM v2 - 2 plasmid system...Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 ...GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid) Knockout Human Doench and Root 3rd... 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 ...20,051 Human GeCKO v2 1000000048 (1 plasmid) 1000000049 (2 plasmid) Knockout Human Zhang 3rd 6 123,411...185,836 Mouse GeCKO v2 1000000052 (1 plasmid) 1000000053 (2 plasmid) Knockout Mouse Zhang 3rd 6 130,209... -
Bacterial Expression Systems
TypeCollection...selection of plasmids and tags for protein purification. The pTD Plasmid Series contains plasmids suitable...Expansion Collection Microbiology Plasmids Collection Synthetic Biology Plasmids Collection Empty Backbones ...under the microscope. The plasmids in this collection are clone-in ready plasmids that contain fluorescent...New England Biolabs Cell-Imaging Plasmid Collection contains plasmids for non-toxic protein labeling and...Optogenetics for E. coli Return to top Reporter Plasmids Reporter plasmids can be used to detect events and molecules...CRISPR plasmids that have been designed for their use in bacteria in our Bacterial CRISPR Plasmids page ...Guide . Browse CRISPR plasmids available at Addgene through our CRISPR Plasmids and Resources page. Check... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...usage of the pSpCas9(BB) plasmid (pX330) (Addgene plasmid ID 42230). This plasmid allows for the simultaneous...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable....Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), which include GFP and puromycin as selectable... with a PCR cloning kit) into a plasmid vector. Transform the plasmid into DH5α E. coli cells and plate... -
Validated gRNA Sequences
TypeCollection...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT... -
Viral Production
TypeCollection...the transfer plasmid, a plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral... coli . In addition, plasmids are typically prepared using endotoxin-free plasmid purification kits. Resources...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...contamination is minimized by using an endotoxin-free plasmid purification protocol. To minimize the immunogenic...off-line and discarded. Confirmation of Transfer Plasmid Addgene uses a rigorous barcode matching system...microbial contamination. Purity When possible, all plasmids used for viral production are propagated in the...experiment using our virus protocols . Browse our plasmid collection of popular lentiviral vectors .... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...pPD95_75 - C-terminal GFP for C. elegans expression pHT101-mCherry - N- or C-terminal mCherry for C. elegans...Species) Organism/Expression System Plasmids Mammalian Golenbock Lab Plasmids - Includes tagging with CFP, YFP...Lentiviral Plasmids - Fluorescently tag your gene for lentiviral expression Verkhusha Lab Plasmids - Enhanced...Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab Plasmids - Includes...mCherry, with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C. elegans Hamdoun Lab Plasmids - Set includes...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Includes many N- and C-terminal fluorescent proteins Insect Sutherland Lab Plasmids - For multicistronic expression... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... on the plasmid. gRNA plasmids that do not co-express a Cas protein require a separate plasmid that does...gRNA Vectors CRISPR Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids By Function Genome ... these independent gRNA plasmids can be paired with a wide variety of plasmids and therefore are not limited.... Whether the plasmid contains Cas9 and if so, which function of Cas9. We have plasmids with Cas9 that...none, need plasmid 65775 N. meningitidis Joung VVT1 65779 Mammalian BsmBI none, need plasmid 65776 S. aureus...expression of Csy4 (eg Plasmid 53369 ). Joung pX333 Mammalian Single all-in-one plasmid for tandem expression...types of plasmids available for use in this Golden Gate and Gateway based assembly method: plasmids for assembly... -
CRISPR Plasmids - Bacteria
TypeCollection...efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter...with a wide variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Validated In...Ampicillin none, need Cas9 plasmid Qi Do you have suggestions for other plasmids that should be added to ...guanosine to create A->G (or T->C on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick...pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9 BsaI E. coli... -
CRISPR Plasmids - Plants
TypeCollection...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter...paired with a wide variety of Cas-containing plasmids. ID Plasmid Promoter Cloning Enzyme Co-expressed Cas9...guanosine to create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable...pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids that should be added to...expression plasmids that have been designed for use in plants. CRISPR... CRISPR Plants CRISPR Plasmids: Plants Browse... -
CRISPR Plasmids - Prime Edit
TypeCollection...the tables below for CRISPR prime editing plasmids. Plasmids are available for expression in mammalian...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert...Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Drosophila ID Plasmid Gene/Insert...selectable marker, and whether the plasmid contains Cas9. ID Plasmid Expression System Promoter Guide RNA...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...prime editor plasmids for (search and replace) genome editing. CRISPR... CRISPR Prime Edit CRISPR Plasmids: Prime Edit... -
CRISPR History and Development for Genome Engineering
TypeCollection...posts , or find CRISPR plasmids for your research. Addgene has CRISPR plasmids for the following models... in the field, and enabling access to multiple plasmids used for various platform applications. For more... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ... -
mTOR Pathway
TypeCollection...proliferation. mTOR Pathway Plasmids Click on a name to find available plasmids for the gene, or browse the...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Pathway Plasmids mTOR Gene List Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) ...Addgene's plasmids for the mTOR pathway. enhanced signaling of mTOR, a key metabolic regulator, correlates... - Gene List Click on a name to find available plasmids for the gene. For components with multiple isoforms...PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...Accessory Plasmids Envelope and Packaging Plasmids Popular Lentiviral Envelope and Packaging Plasmids Popular...Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that can be used for...particles See Addgene's Viral Plasmids and Resources page for more information. Plasmids Expressing Spike and ...COVID-19 and Coronavirus Plasmids & Resources Ginkgo Bioworks COVID-19 Plasmid Collection Return to top...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene's collection of plasmids for viral pseudotyping with SARS-CoV-2 spike protein. Collections...circulating variants. The table below lists expression plasmids that are suitable for generating pseudotyped virus...