We narrowed to 22 results for: cag promoter
-
TypeCollection...fluorescent protein EYFP from the CAG promoter Viviana Gradinaru 104055-AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously...fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104055-AAV5 pAAV-CAG-eYFP An AAV genome that ubiquitously...fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104055-AAVrg pAAV-CAG-eYFP An AAV genome that ...fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104055-PHPeB pAAV-CAG-eYFP An AAV genome that ...fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104061-PHPeB CAG-NLS-GFP AAV expression of nuclear...expression of dLight1.1 under CAG promoter Lin Tian 111067-AAV5 pAAV-CAG-dLight1.1 To generate Adeno-Associated...Li 158757-AAV8 pAAV-CAG-SomaGCaMP6f2 Cell body-targeted GCaMP6f, under CAG promoter: GCaMP6f followed by...
-
Caltech Systemic Capsids
TypeCollection...Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP Control Gradinaru...pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE CAG Calcium sensor, Cre-dependent GCaMP Kim , GENIE 104496 pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE... PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent ...Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2...Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-...Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-...Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden AAV9... -
Control AAV Preps
TypeCollection...104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP Constitutive... Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive ... pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 197200 pAAV-CAG-emiRFP670...pAAV-CAG-FLEX-EGFP CAG EGFP Cre dependent 1 Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1 Gradinaru...51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8, 9, rg* Zeng 59331 pAAV-CAG-FLEX-EGFP ...PHP.V1 CAP-B10 CAP-B22 MaCPNS1 MaCPNS2 AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin...GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, ... -
Brain Armamentarium
TypeCollection...Wilson 37825-CAP-B10 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...Gradinaru 37825-CAP-B22 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...Gradinaru 37825-CAP-MaCPNS1 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...Gradinaru 37825-CAP-MaCPNS2 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana Gradinaru...Viviana Gradinaru 163489-AAV1 AiP1051-pAAV-Synapsin promoter-oNigri-WPRE-hGHpA Direct-expressing oNigri AAV... -
Biosensor AAV Preps
TypeCollection...pAAV-CAG-iSeroSnFR-Nlgn CAG iSeroSnFR none Constitutive 9 Tian 128486 pAAV-CAG-FLEx-iSeroSnFR CAG iSeroSnFR...ATP Sensors iATPSnFR2 5-HT Sensors GRAB_5-HT Promoter CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory...dependent 1, 5, 9, rg* GENIE 162382 pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE CAG jGCaMP8f none Cre dependent 1, 5, 9, ...none Constitutive 1, 9 Looger 179254 AAV-CAG-jGCaMP8f-WPRE CAG jGCaMP8f none Constitutive 1, 9, rg* Looger...dependent 1, 9, rg* GENIE 162380 pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE CAG jGCaMP8s none Cre dependent 1, 9, rg*...none Constitutive 1, 9 Looger 179256 AAV-CAG-jGCaMP8s-WPRE CAG jGCaMP8s none Constitutive 1, 9, rg* Looger...dependent 1, 9, rg* GENIE 162381 pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE CAG jGCaMP8m none Cre-dependent 1, 5, 9, ... -
The Pleiades Promoter Project
TypeCollection...Positive Control CAG promoter pEMS1293 cre N/A CAG promoter pEMS1164 EGFP/cre N/A CAG promoter pEMS1114 EGFP...cre/NLS N/A CAG promoter pEMS1157 EGFP/NLS N/A CAG promoter pEMS1277 EGFP/NLS N/A CAG promoter pEMS1294 ...Collections Pleiades Promoter Plasmids Pleiades Promoter Project The Pleiades Promoter Project (Link opens...pEMS1294 intron-lacZ/NLS N/A CAG promoter pEMS1488 intron-lacZ/NLS References Portales-Casamar, E., Swanson, ...Plasmids from the Pleiades Promoter Project - A regulatory toolbox of MiniPromoters to drive selective expression...mouse brain through these human MiniPromoters. Browse the Pleiades Promoter Plasmids using the table below...Portales-Casamar et al., 2010 . List of Pleiades MiniPromoters MiniPromoter Source Gene Construct Reporter Ple2 ADORA2A... -
Luciferase Plasmid Collection
TypeCollection... Zea mays ubiquitin promoter. Paul Schulze-Lefert 83282 pAAV-CAG-RLuc Renilla CAG AAV expression of Renilla...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...luciferase expression Stephen Tapscott 83281 pAAV-CAG-FLuc Firefly CAG AAV expression of firefly luciferase Mark...Renilla luciferase Mark Kay 83280 pscAAV-CAG-RLuc Renilla CAG Vector for packaging self-complementary ...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...Jorge Ferrer 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248... -
Optogenetics AAV Preps
TypeCollection...28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2... pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG Jaws GFP Cre dependent 1, 5, rg* Boyden 84446 pAAV-CAG-FLEX-rc...Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV CAG ChR2 Venus ...stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx EF1a/nEF Synapsin E2 regulatory...Constitutive 1, 2, 5, 9 Deisseroth 127090 pAAV-CAG-DIO-ChR2(H134R)-eYFP CAG ChR2/H134R EYFP Cre dependent PHPeB ...Constitutive 8 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent...Cre dependent 9 Harvey 108912 pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3 CAG ChroME (soma-targeted) mRuby3 Cre... -
AAV Molecular Tools
TypeCollection...Expression System Activity Serotype PI 99118 pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off...separate) tdTomato 8 Scanziani 34910 paavCAG-pre-mGRASP-mCerulean CAG-driven, constitutive Expression of... connectivity mapping 5 Kim 34912 paavCAG-post-mGRASP-2A-dTomato CAG-driven, constitutive Expression of...Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator...pAAV-ihSyn1-DIO-tTA Cre-dependent and inducible Synapsin promoter (ihSyn) Cre-dependent expression of the tet-off... -
TALEN Plasmids and Kits
TypeCollection...the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7 promoter. Truncations...directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed for in vitro...DNA sequences within core promoter regions. pTAL5-BB contains the GAL1 promoter, placing TALORs built into...fragment for blue/white-screening in E.coli , (iii) CAG promoter and Kozak sequence to drive efficient TALEN ...galactose-inducible expression. pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs built...double-transfected mammalian cells. In addition, a T7 promoter was included for generating TALEN mRNAs through...expression. The vectors listed below have the EF1α promoter for efficient mammalian cell expression, and encode... -
Recombinases AAV Preps
TypeCollection...183412 pAAV-CAG-FlpO CAG none 1, rg* Janelia Light-Inducible Recombinases ID Name Promoter Fluorophore...information about these molecular tools. Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40....PI.Cre.rBGe TBG none 8 Wilson Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)...DreO-bGHpA Syn none 5, rg* Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...pAAV-EF1a-iFlpV EF1a none 1, PHPeB Zeng VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre... -
Retrograde AAV viral preps
TypeCollection...ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE...pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE CAG GCaMP7s, Cre-dependent Calcium sensor Kim 104496 pGP-AAV-CAG-FLEX-jGCaMP7f-WPRE...pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE CAG GCaMP8s, Cre-dependent Calcium sensor GENIE 162381 pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE...-WPRE CAG GCaMP8m, Cre-dependent Calcium sensor GENIE 162382 pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE CAG GCaMP8f...179254 AAV-CAG-jGCaMP8f-WPRE EF1a GCaMP8f Calcium sensor Looger 179255 AAV-CAG-jGCaMP8m-WPRE CAG GCaMP8m ...mCherry, Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP...pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 112677 pOTTC1032 - pAAV... -
Serotype Testing AAV
TypeCollection... Boyden ) and direct GFP expression from the CAG promoter. For information about each catalog item, including...example, AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV...direct EGFP expression from the human synpasin promoter. For information about each catalog item, including... -
Tetracycline Inducible Expression
TypeCollection...Viviana Gradinaru 104102 pCAG-tTA Mammalian expression of tTA from the CAG promoter for Tet-Off tTA-Advanced...may also like... Blog: Inducible Promoters Blog: Repressible Promoters Mammalian shRNA Plasmids Collection...upstream of a minimal CMV promoter, and other tet- or dox-dependent promoters (sometimes generally called... CMV promoter. In the absence of tetracycline, tTA binds to the TRE and its VP16 domain promotes gene ...transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter, and type ...from EF1α promoter, for Tet-Off. See Plasmid #27106 for rtTA. tTA Edward Hsiao 99118 pAAV-CAG-tTA AAV Tet-Off... Tet-Off vector, expresses tTA from the CAG promoter. See article ( Chan et al., 2017 ) for other viral... -
Chemogenetics AAV Preps
TypeCollection...DREADD KOR DREADD PSAM4 GlyR Promoter Synapsin CaMKIIa CD68 Dlx GFAP nEF CAG E2 regulatory element Tag Fusion...mCherry fusion none 1, 2, 5, 8, 9, rg* Roth 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...proteins, a multiple cloning site (MCS), an inducible promoter, and/or a selectable marker. They are frequently...Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient expression - Gradia Lab plasmids for...T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter and Hygromiycin resistance marker Also see more... expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC - Vectors from... -
Neurodegeneration Plasmid Collection
TypeCollection...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...Friedreich ataxia Michael Ristow 14994 pDRIVE-CAG-hFX-HA FXN HA, AU1 CAG Friedreich ataxia Michael Ristow 15239...wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 NOTAG1 TARDBP CAG ALS Zuoshang Xu 28207 TDP43...TDP43 NOTAG2 TARDBP CAG ALS Zuoshang Xu 28208 TDP43 NOTAG3 TARDBP CAG ALS Zuoshang Xu 28209 TDP43 NOTAG6...NOTAG6 TARDBP CAG ALS Zuoshang Xu 28210 TDP43 NOTAG11 TARDBP CAG ALS Zuoshang Xu 29340 pcDNA3.1/GS-DJ1-R98Q-V5...30137 pCAX APP 695 APP CAG Alzheimer's Dennis Selkoe 30138 pCAX APP 751 APP CAG Alzheimer's Dennis Selkoe...pCAX APP delta CT APP CAG Alzheimer's Dennis Selkoe 30144 pCAX APP AENATA APP CAG Alzheimer's Dennis Selkoe... -
Validated gRNA Sequences
TypeCollection... H. sapiens GCAGGTAGCAAAGTGACGCCGA 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae...cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT.... pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes 23977949...S. cerevisiae TGTATGTACATACAGTACCC 64386 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...scaffold S. pyogenes 25533786 Qi & Lim TET promoter TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... -
Lentivirus Plasmids
TypeCollection...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...35617 pCAG-Eco N/A Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG... -
Synthetic Biology - Assembly Standards Guide
TypeCollection.... Therefore, the same reaction which ligates a promoter into an empty backbone can be repeated to ligate...ligate your gene of interest after the promoter, and so on. The following table provides information for... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG...Enzymes: EcoR1 , NotI , Spel Suffix: GCTAGC GCGGCCG CTGCAG Suffix Enzymes: Nhel , NotI , PstI Scar: GCTAGT... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: ACTAGA..., (NgoMIV) Suffix: ACCGGT TAAT ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: Agel , Spel , Notl, Pstl Scar: ...