Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 24 of 24 results

  1. Rett Syndrome

    Type
    Collection
    ...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell...

  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 58112 tdTomato-MAPTau-C-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58113 tdTomato-MAPTau-...TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 ...tdTomato-MAPTau-N-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan...

  3. Validated gRNA Sequences

    Type
    Collection
    ...ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N...
Showing: 21 - 24 of 24 results