Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 12 results for: lacz gene

Showing: 1 - 12 of 12 results

  1. The Pleiades Promoter Project

    Type
    Collection
    ...pEMS1492 intron-lacZ/NLS Ple22 CCKBR pEMS1493 intron-lacZ/NLS Ple23 CCKBR pEMS1494 intron-lacZ/NLS Ple24 CCKBR...pEMS1495 intron-lacZ/NLS Ple25 CCKBR pEMS1496 intron-lacZ/NLS Ple26 CCL27 pEMS1497 intron-lacZ/NLS Ple27 CCL27...pEMS1498 intron-lacZ/NLS Ple28 CCL27 pEMS1499 intron-lacZ/NLS Ple29 CCL27 pEMS1500 intron-lacZ/NLS Ple30 CD68...pEMS1504 intron-lacZ/NLS Ple34 CLDN5 pEMS1505 intron-lacZ/NLS Ple35 CLDN5 pEMS1506 intron-lacZ/NLS Ple36 CRH...pEMS1593 intron-lacZ/NLS Ple123 ICMT pEMS1594 intron-lacZ/NLS Ple124 ICMT pEMS1595 intron-lacZ/NLS Ple125 ...pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602 intron-lacZ/NLS Ple135...pEMS1650 intron-lacZ/NLS Ple179 RLBP1L2 pEMS1651 intron-lacZ/NLS Ple180 RLBP1L2 pEMS1652 intron-lacZ/NLS Ple181...

  2. Zhang Lab CRISPR Page

    Type
    Collection
    ...the neuronal-specific gene NeuN. As a control they designed an sgRNA targeting LacZ, which is not present...sgRNA targeted to the mouse NeuN gene. #60228 - AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid... information, please visit the Addgene SAM library page . Targeted gene activation using SAM There are...available for mammalian endogenous gene activation using SAM: Addgene plasmids #61422 - #61424 were designed...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically...human codon-optimized, and packages both the SaCas9 gene and its single guide RNA (sgRNA) into one plasmid...

  3. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your gene of ...and puromycin resistance gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from ...pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter pCDH-EF1s 72484 Express gene of interest from ...Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345 Expresses lacZ from the CMV promoter, forms blue colonies...Kazuhiro Oka from the Baylor College of Medicine Gene Vector Core Viral...Lentiviral Vectors Baylor College of Medicine Gene Vector Core Lentiviral and Adenoviral Vectors You may...

  4. Zinc Finger Consortium: OPEN Reagents

    Type
    Collection
    ...temperature. ID Name 13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4...article in which they were created, and include Addgene in the Materials and Methods of your future publications... this publication was a gift from Keith Joung (Addgene kit # 1000000013)" For your Reference section: ...

  5. Worm Expression Resources

    Type
    Collection
    ...briggsae , etc.) gene or sequence: ID Plasmid Gene/Insert PI Don’t see your gene listed? Know of some great...can knock down genes by feeding worms bacteria expressing dsRNA or use CRISPR/Cas9 gene editing to easily... used in worms, search Addgene's entire collection. ID Plasmid Description Gene/Insert PI Plasmids Expressing...which diminishes epigenetic silencing in the germline. A "FLP-Out" system for controlled gene expression in...Expressing Worm Genes/Inserts The table below lists plasmids that contain a worm ( C. elegans, C. briggsae...set of vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...Plasmids for the temporal and spatial control of gene expression in C. elegans by combining expression...

  6. TALEN Plasmids and Kits

    Type
    Collection
    ... order to generate TALORs (TAL Orthongal Repressors) that can be used to custom repress gene expression... successfully been employed for deletion mutagenesis and gene targeting in human and mouse pluripotent...compatibility with the Golden Gate TALEN kit, (ii) a lacZ fragment for blue/white-screening in E.coli , (iii...editing was also shown to alter regulation of nearby gene expression. The vectors listed below have the EF1α...kits and accessory plasmids available from Addgene for generating your own specific TALE plasmids. Genome... TALEN Plasmids and Kits You may also like... Addgene's Genome Engineering Guide CRISPR Plasmids Zinc ...amino acid repeats in the TAL effectors. View Addgene's TALEN Guide. These collections and accompanying...

  7. Control AAV Preps

    Type
    Collection
    ..., 5, 8, 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV....control AAV that express fluorescent proteins under general promoters. These AAV can be used to compare the...

  8. Validated gRNA Sequences

    Type
    Collection
    ...60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330 Zhang...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...

  9. Bacterial Expression Systems

    Type
    Collection
    ...Plasmids containing easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under...knocking out genes or introducing specific mutations can reveal important insights into gene function. These...expression of a gene of interest in E. coli . The Marionette Sensor Collection (Addgene #1000000137) allows...of up to twelve genes using small-molecule inducers in the same E. coli strain. Addgene Blog Inducible ...bacterial gene biology or engineering metabolic pathways to synthesize a target metabolite, genetic tools ...visualization, study of protein interactions, controlled gene expression, reporter plasmids and genome engineering...transcriptional regulatory elements that will turn on gene expression upon protein–protein interaction. The...

  10. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... distribution via Addgene. For a full list of Addgene's viral vectors See Addgene's Current AAV inventory... from the Penn Vector Core. Chemogenetics (including DREADDs) Optogenetics Recombinases Calcium Sensors... are now available for distribution at Addgene: Penn ID Addgene ID Name Function PI AV-1-49531P 100040...tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2-Venus-AAV Optogenetics Karel Svoboda...mCherry.WPRE.SV40 Optogenetics Karl Deisseroth AV-1-26966P 26966-AAV1 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics Karl...eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-1-26968P 26968-AAV1 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics Karl Deisseroth...EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics Karl...

  11. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y MAPT LacZ TRE Parkinson's, FTD Mark Mayford 35000...protein (FP) tags. Information on genes and associated neurodegenerative diseases was curated from several...but not exhaustive. If you do not see a particular gene of interest, please search our full plasmid collection... Huntington's Disease Parkinson's Disease Others Gene Type Wildtype Mutant Partial Sequence Codon-Optimized... T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI 1177 p416 25Q GPD HTT GFP... Neurodegeneration Neurodegeneration Plasmids Neurodegeneration Plasmid Collection Addgene has a ...Spinal muscular atrophy Eugene Yeo 156073 TARDBP TARDBP V5-MCP EF1a ALS Eugene Yeo 156883 pD649-HAsp-CSF1R-Fc...

  12. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes are assembled into...capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas Do you have suggestions...yes, cut S. pyogenes NatMX Zaratiegui All_in_one_CRISPR/Cas9_LacZ 74293 Mammalian S. pyogenes Neo, mCherry...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...
Showing: 1 - 12 of 12 results