Skip to main content
Addgene

We narrowed to 21 results for: t aav

Showing: 1 - 20 of 21 results
  1. Serotype Testing AAV

    Type
    Collection
    ...Service AAV Serotype Testing AAV Viral Vector Packaging Service: Serotype Testing AAV These AAV encode ...37825-AAV5.T 20 µL $ 150 Add to Cart AAV6 37825-AAV6.T 20 µL $ 150 Add to Cart AAV8 37825-AAV8.T 20 µL $ 150... Cart AAV9 37825-AAV9.T 20 µL $ 150 Add to Cart AAV11 37825-AAV11.T 20 µL $ 150 Add to Cart AAV Retrograde...50465-AAV5.T 20 µL $ 150 Add to Cart AAV8 50465-AAV8.T 20 µL $ 150 Add to Cart AAV9 50465-AAV9.T 20 µL $ 150...Price* AAV1 37825-AAV1.T 20 µL $ 150 Add to Cart AAV2 37825-AAV2.T 20 µL $ 150 Add to Cart AAV5 37825-...Price* AAV1 50465-AAV1.T 20 µL $ 150 Add to Cart AAV2 50465-AAV2.T 20 µL $ 150 Add to Cart AAV5 50465-...150 Add to Cart AAV11 50465-AAV11.T 20 µL $ 150 Add to Cart AAV Retrograde 50465-AAVrg.T 20 µL $ 150 Add...
  2. Optogenetics AAV Preps

    Type
    Collection
    ...C1V1 (t/t)-TS-EYFP EF1a C1V1 (t/t) EYFP Cre dependent 9 Deisseroth 35499 pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP...TS-EYFP CaMKII C1V1 (t/t) EYFP Constitutive 9 Deisseroth 124650 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 CaMKII...pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry EF1a C1V1 (t/t) mCherry Cre dependent 9 Deisseroth 105448 pAAV-hSyn-DIO-ChrimsonR-mRuby2...Browse all Optogenetics AAV *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from...high quality AAV preps from select plasmids in the repository. Browse our optogenetics AAV collection, ...Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics AAV Optogenetic tools ...CaMKII C1V1 (t/t) mScarlet Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive...
  3. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...You may also like: Viral Service: All AAV Viviana Gradinaru PHP AAV Serotypes Blog: Viral Vectors As part...Y730F, T491V, R487G, R585S, and R588T. AAV6(dbY-F+T-V) The AAV6(dbY-F+T-V) serotype displays enhanced transduction...15;8:184-197. PMID: 28918020 AAV6(dbY-F+T-V) When using the AAV6(dbY-F+T-V) serotype in future publications... The AAV6(dbY-F+T-V) serotype was developed by Arun Srivastava’s lab. It is derived from the AAV6 capsid...We provide high quality AAV preps from select plasmids in the repository. Browse the University of Florida... Viral Vector Packaging Service AAV University of Florida Serotype Testing Panel for ...viral vectors undergo quality control, including AAV titration by ddPCR, in vitro and (when possible) ...
  4. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Systemic Capsids AAV Packaged on Request AAV Guide Plasmids Publications Enhancer AAV plasmids are plasmids...Institute for Brain Science AAV Enhancer Collection Allen Institute for Brain Science AAV Enhancer Collection ...Barcelli T, Barta S, Bendrick J, Bertagnolli D, Bowlus J, Boyer G, Brouner K, Casian B, Casper T, Chakka...Malone J, Mollenkopf T, Morin E, Newman D, Ng L, Ngo K, Omstead V, Oyama A, Pham T, Pom CA, Potekhina L..., Walker M, Weed N, Wirthlin M, Wood T, Wynalda B, Yao Z, Zhou T, Ariza J, Dee N, Reding M, Ronellenfitch...Find AAV enhancer plasmids for fluorescent labeling and recombination across brain regions and populations...across brain regions and populations using systemic AAV delivery. The collection includes the top vectors...
  5. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...C1V1 (t/t)-TS-EYFP Optogenetics Karl Deisseroth AV-9-35498M 100061-AAV9 pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry...-9-PV2453 45185-AAV9 AAV-EF1a-BbTagBY Control Joshua Sanes AV-9-PV2454 45186-AAV9 AAV-EF1a-BbChT Control...Deisseroth AV-9-35499 35499-AAV9 pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP Optogenetics Karl Deisseroth AV-9-35505 ...18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2-Venus-AAV Karel Svoboda...18916P 18916-AAV9 AAV-FLEX-rev-ChR2(H134R)-mCherry Scott Sternson AV-9-18917P 18917-AAV9 AAV-FLEX-rev-ChR2... AV-5-PV2432 22222-AAV5 AAV-FLEX-Arch-GFP Ed Boyden AV-1-ALL864 51503-AAV1 AAV pCAG-FLEX-tdTomato-WPRE...1-27056 27056-AAV1 pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE...
  6. Tetracycline Inducible Expression

    Type
    Collection
    ...APEX targeting Alice Ting 85040 pK170.AAV-TRE-Cre-WPRE (Supernova) AAV vector for dox-inducible expression...sgRNA TetR H1-2O2 Nathanael Gray 35625 pAAV-Ptet-RFP-shR-rtTA AAV Tet-On shRNA vector. To evaluate shRNA...promoter Tet-On 3G rtTA David Vereide 120309 pAAV-FAH-rtTA3G AAV vector to express Tet-On 3G transactivator...promoter TetR Eric Campeau , Paul Kaufman 175274 pAAV-rtTA AAV Tet-On vector with neuron-specific expression...Plasmid #27106 for rtTA. tTA Edward Hsiao 99118 pAAV-CAG-tTA AAV Tet-Off vector, expresses tTA from the CAG... Tet-Off tTA-Advanced Takeshi Imai 104109 pAAV-Syn1-tTA AAV Tet-Off vector, expressed tTA from the hSyn...transactivators and inducible tools or consider our AAV Packaged on Request service available for many transactivator...
  7. AAV for Neuronal Tracing

    Type
    Collection
    ... Tracing These AAV encode tools for rabies virus-based monosynaptic tracing. These AAV can be used with...steps for using AAV and modified rabies virus (RABV) for monoclonal neuronal tracing. (1) AAV encoding TVA...deletion-mutant rabies virus AAV1 Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA These AAV together can be used...virus. AAV Vectors for Monosynaptic Neuronal Tracing ID Name Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G...Ready-to-use AAV available from Addgene's viral service encoding tools for monosynpatic retrograde neuronal... Viral Vector Packaging Service AAV Monosynaptic Neuronal Tracing Viral Vector Packaging...to the starter cell in trans , via delivery by an AAV. Since this starter cell now has all the viral genes...
  8. Plan Your Experiment

    Type
    Collection
    ... collection of in-stock lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector...delivery. Both lentiviral and AAV vectors are safe to use in the lab, but AAVs exhibits the lowest immunogenicity... transgene expression with AAVs can be long-lived, despite recombinant AAVs not integrating into the host...also frequently use AAVs to develop CRISPR-based therapeutics. One limitation of AAV vectors is that the...blog post on overcoming the AAV size limitation . Browse Addgene's in-stock AAV preps or try Addgene's Packaged...Marjanovic, N. D., Dionne, D., Burks, T., Raychowdhury, R., Adamson, B., Norman, T. M., Lander, E. S., Weissman...delivery, lentiviral and adeno-associated virus (AAV) vectors are the most common. Using viral vectors...
  9. Luciferase Plasmid Collection

    Type
    Collection
    ...Schulze-Lefert 83282 pAAV-CAG-RLuc Renilla CAG AAV expression of Renilla luciferase Mark Kay 83280 pscAAV-CAG-RLuc...Description PI 60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Renilla EF1α AAV-CRISPR knockout...William Hahn, David Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase...luciferase expression Stephen Tapscott 83281 pAAV-CAG-FLuc Firefly CAG AAV expression of firefly luciferase Mark...Mark Kay 105532 pAAV.CMV.ffLuciferase.SV40 Firefly CMV AAV expression of firefly luciferase James Wilson...expressing luciferase. We also offer ready-to-use AAV preparations of select luciferase expression plasmids...Renilla CAG Vector for packaging self-complementary AAV expressing Renilla luciferase Mark Kay 140328 pLenti-PGK-Venus-Fluc...
  10. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... smaller than SpCas9 and more easily packaged in AAV. Cas9 orthologs also have distinct PAM sites that...also makes it suitable for multiplexing and use in AAV. Scientists have also developed CRISPR editing technologies... Biotechnol . 32(3):279-84. PMID: 24463574 Fujita T, Fujii H. 2013. Efficient isolation of specific genomic...A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling of chromosomal loci...Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T. 2016. Multiplexed labeling of genomic loci with dCas9...Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. 2014...specificity. Science . 351(6268):84-8. PMID: 26628643 Wang T, Wei JJ, Sabatini DM, Lander ES. 2014. Genetic Screens...
  11. CRISPR Guide

    Type
    Collection
    ...INTEGRATE ( I nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting), developed by Samuel...Topkar, V. V., Nguyen, N. T., Zheng, Z., Gonzales, A. P. W., Li, Z., Peterson, R. T., Yeh, J. J., Aryee, M...PMID: 28041849 Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., & Yamamoto, T. (2014). Multiplex genome... R. T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C.,... (22), 5635-5652.e29. PMID: 34653350 Chu, V. T., Weber, T., Wefers, B., Wurst, W., Sander, S., Rajewsky... Gao, L., Cox, D. B. T., Yan, W. X., Manteiga, J. C., Schneider, M. W., Yamano, T., Nishimasu, H., Nureki...Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo, T. (2019). CRISPR-Cas3 induces...
  12. Mammalian RNAi Tools

    Type
    Collection
    ... a lentiviral backbone, with some retroviral and AAV backbone options. Plasmids for constitutive expression...window) . Moore, C. B., Guthrie, E. H., Huang, M. T., Taxman, D. J. (2010). Short hairpin RNA (shRNA):...
  13. Retrovirus Plasmids

    Type
    Collection
    ...γ-Retrovirus Guide Biosafety Guide Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook γ-Retrovirus (gamma-retrovirus...1780 pBABE-neo largeTcDNA MoMLV Expression of Large T antigen for creation of immortalized cells (see Weinberg...
  14. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2...PMP34 Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1... Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP-69 mTagRFP-T Nucleophosmin Nucleolus (granular component...114403 LMNB1-mTagRFP-T AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36...References Roberts B, Haupt A, Tucker A, Grancharova T, Arakaki J, Fuqua MA, Nelson A, Hookway C, Ludmann...mEGFP Ras-related protein Rab-5A Endosomes 107580 AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of ...
  15. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...protein production AAV-GfaABC1D-MCS--4x6T-WPRE - For astrocyte-selective expression in AAV Dual promoter Separate...Advantages Representative Empty Backbones AAV High transduction efficiency, but do NOT integrate...expression, see our dedicated Adeno-associated Virus (AAV) Plasmids page Lentiviral Can transduce both dividing...Ubiquitin pYPQ203 (pMDC32-Ubi1) - Multisite Gateway T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter...
  16. Deisseroth INTRSECT Collection

    Type
    Collection
    ...targeting strategy that allows adeno-associated virus (AAV)-borne payloads to be expressed in cells based on... Chuhma N, Mingote S, Yetnikoff L, Kalmbach A, Ma T, Ztaou S, Sienna AC, Tepler S, Poulin JF, Ansorge ...Müller K, Fenno L, Kim YS, Ramakrishnan C, Andrási T, Deisseroth K, Holmes A, Hájos N. 2019. Excitation... C, Dorrier CE, Tipton GJ, Ramakrishnan C, Kozicz T, Deisseroth K, Thiele TE, McElligott ZA, Holmes A,... Items 55636 pAAV-EF1a-Cre None Yes 55632 pAAV-Ef1a-mCherry-IRES-Cre None Yes 55637 pAAV-EF1a-Flpo None...None Yes 55634 pAAV-EF1a-mCherry-IRES-Flpo None Yes 55638 pAAV-EF1a-vCre None Yes 55635 pAAV-EF1a-sCre None...Items 55641 pAAV-Ef1a-fDIO EYFP Flp Yes 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre No 55639 pAAV-Ef1a-fDIO...
  17. Immunology Research Plasmids and Resources

    Type
    Collection
    ... TRAJ10 T cell receptor alpha joining 10 - TRAJ11 T cell receptor alpha joining 11 - TRAJ12 T cell receptor... TRAJ13 T cell receptor alpha joining 13 - TRAJ14 T cell receptor alpha joining 14 - TRAJ15 T cell receptor... TRAJ16 T cell receptor alpha joining 16 - TRAJ17 T cell receptor alpha joining 17 - TRAJ18 T cell receptor... TRAJ20 T cell receptor alpha joining 20 - TRAJ21 T cell receptor alpha joining 21 - TRAJ22 T cell receptor... TRAJ23 T cell receptor alpha joining 23 - TRAJ24 T cell receptor alpha joining 24 - TRAJ25 T cell receptor... TRAJ26 T cell receptor alpha joining 26 - TRAJ27 T cell receptor alpha joining 27 - TRAJ28 T cell receptor...- TRAJ29 T cell receptor alpha joining 29 - TRAJ3 T cell receptor alpha joining 3 - TRAJ30 T cell receptor...
  18. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pX601 61591 Mammalian/AAV BsaI yes, cut S. aureus Zhang pX602 61593 Mammalian/AAV BsaI yes, cut S. aureus...pyogenes Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes...pyogenes mCherry Kuhn AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR 60229 Mammalian/AAV SapI none S. pyogenes...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI none S...particular expression system , eg. Mammalian, Lentiviral, AAV, Bacteria, Drosophila, Yeast, Plant, Xenopus, Worm... none S. pyogenes Gersbach PX552 60958 Mammalian/AAV SapI none S. pyogenes Zhang pgRNA-humanized 44248...
  19. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286 Mouse Validation (mVAL) CRISPR Library 159391...Prime Editing Other Species Human Mouse Fly Yeast T. gondii E. coli P. aeruginosa S. pneumoniae M. tuberculosis...Moffat 3rd 4 70,948 Toxoplasma Knockout 80636 Knockout T. gondii Lourido N/A 10 8,158 TUNEYALI Library 217744...
  20. Validated gRNA Sequences

    Type
    Collection
    ...48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola...TGAAGAAAGTTATACTCGA 66099 cut S. pyogenes 25249454 Seydoux T (BRACHYURY) H. sapiens CACGCGCAGTTCGCGCTCTG 59726 ...69239 cut S. pyogenes 26480473 Wolfe TGME49_290860 T. gondii ATTGGTCTGACAGCGATGTG 59855 cut S. pyogenes...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...
Showing: 1 - 20 of 21 results