Skip to main content
Addgene

We narrowed to 5 results for: CAG promoter

Showing: 1 - 5 of 5 results
  1. Promoters

    Type
    Guide
    ...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter from phospholycerate...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...
  2. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetic Plasmids ! Table 4. Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor... GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Targeted expression. Depending...
  3. Molecular Biology Reference

    Type
    Guide
    ...human cells, the promoter will be a human or mammalian promoter sequence. The promoter can also direct ...tissue-specific promoter (e.g., a liver-specific promoter). The strength of the promoter is also important...particular plasmid. Promoter Region Drives transcription of the insert. The promoter is designed to recruit...expression (i.e., a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous...information about promoters, both bacterial and eukaryotic, as well as common promoters used in research...contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region... of Replication Plasmids 101: The Promoter Region-Let’s Go Promoters Reference Page Plasmids 101: How ...
  4. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...
  5. Optogenetics Guide

    Type
    Guide
    ...expression of the opsin. Depending on the virus and promoter system used, there is an incubation time (days...Light-inducible Dronpa mutant domains that associate and cage a protein in the dark, while dissociate and activate...
Showing: 1 - 5 of 5 results